Supplementary Materials and Methods

Supplemental Materials and Methods ... in combination with Mascot search engine for peptide and ... Cell proliferation assay...

0 downloads 231 Views 9MB Size
Supplemental Materials and Methods Cells, antibodies and reagents KG-1 cells were cultured in RPMI 1640 supplemented with 10% fetal calf serum and antibiotics. For SILAC labeling of KG-1 cells

13

C615N4 L-arginine and

13

C615N2 L-Lysine (both

Cambridge Isotopes, Andover, USA) were used. Regarding the primary AML cells all patients gave written informed consent. Baseline morphology, cytogenetics and cell surface antigen analysis were performed as part of the routine clinical evaluation. Immunomagnetically enriched CD34+ cells were maintained in liquid culture (X-Vivo 10, Lonza, Basel, Switzerland) supplemented with 10% FBS (HyClone, Perbio, Aalst, Belgium), 1% L-Glutamin (Gibco, Darmstadt, Germany), interleukin-3, thrombopoietin (25 ng/mL each), stem cell factor and flt-3 ligand (50 ng/mL each, Peprotech, Hamburg, Germany) with medium changes to 2 x 105 cells/ml every 7 days. Antibodies for western-blot analyses recognized (p)Syk(Tyr525/526), SLP65, pTyr(4G10), (p)STAT3(Tyr705), (p)STAT5(Tyr694), Pim1, Socs3 and actin (all from Cell Signaling Technology (Danvers, USA) or Santa Cruz Biotechnology (Santa Cruz, USA)). Antibodies recognizing FcRγ were purchased from Millipore (Billerica, USA), the antibodies recognizing CD18 and Mac-1 were purchased from Novus Biologicals (Littleton, USA). For immobilization of antibodies Protein A/G Sepharose was used (Santa Cruz Biotechnology). The Syk inhibitor Bay 61-3606 (Merck, Darmstadt, Germany) was resuspended in H2O and was stored at -20°C; it was used in a final concentration of 250nM. Calf intestinal alkaline phosphatase (CIP (New England Biolabs, Ipswich, USA)) was subjected to cleared cellular lysates for 30 min at 37 °C for dephosphorylation of proteins in vitro. Vectors and cell transduction Sequences targeted by each Syk shRNA were described previously4. shRNAs targeting Syk, FcRγ-, Mac-1- or CD18 were purchased from Sigma-Aldrich and the shRNA encoding sequences were cloned into pLKO.1 vectors for lentiviral transduction. The following shRNA constructs were used: shRNA specific for FcRγ: Sigma-TRCN 0000057454. shRNA specific for Mac-1: Sigma-TRCN 0000414619. shRNA specific for CD18: Sigma-TRCN 0000029643. Cloning of the oligonucleotides and cell infections were performed as described previously4. The retroviral vectors pMSCV-iGFP, pMSCV-iGFPcaSTAT3 and pMSCV-iGFP-caSTAT5A were kindly provided by C. Wichmann and R. Moriggl. The STAT3 cDNA was manipulated by site-directed mutagenesis in a way that upon expression cysteine residues substituted A661 and N663 of STAT322. The cDNA encoding for constitutively active STAT5A harbors point mutations resulting in the replacement of S711 by phenylalanine on the protein level23. Retroviral transductions were performed as described previously24.

Mass

spectrometric

analysis,

database

search

and

MaxQuant-based

protein

quantification All slices were reduced with 10mM DTT for 55 min at 56°C, alkylated with 55mM IAA for 20 min at 26°C and digested with modified trypsin (Promega, Madison, USA) overnight at 37°C. Tryptic peptides were injected into a C18 precolumn (1.5cm, 360µm o.d., 150µm i.d., Reprosil-Pur 120A°, 3µm, C18-AQ, Dr Maisch GmbH) at a flow rate of 10 ml/min. Bound peptides were eluted and separated on a C18 capillary column (15cm, 360µm o.d., 75µm i.d., Reprosil-Pur 120A°, 3µm, C18-AQ, Dr Maisch GmbH) at a flow rate of 300 nl/min, with a gradient from 7.5 to 37.5% ACN in 0.1% formic acid for 50 min using an Agilent 1100 nanoflow LC system (Agilent Technologies, Böblingen, Germany) coupled to an LTQ-Orbitrap XL hybrid mass spectrometer (Thermo Fisher Scientific, Waltham, USA). MS conditions were as followed: spray voltage, 1.6kV; heated capillary temperature, 150°C; normalized collisioninduced dissociation (CID) collision energy 37.5% for MS/MS in LTQ. An activation q=0.25 and activation time of 30 ms were used. The mass spectrometer was operated in the datadependent mode to automatically switch between MS and MS/MS acquisition. Survey MS spectra were acquired in the Orbitrap (m/z 350–1600) with the resolution set to 30000 at m/z 400 and automatic gain control target at 5x105. The five most intense ions were sequentially isolated for CID MS/MS fragmentation and detection in the linear ion trap. Ions with single and unrecognized charge states were excluded. Raw data were analysed with MaxQuant software (Version 1.0.13.13) in combination with Mascot search engine for peptide and protein identifications (Version 2.2.07, Matrix Science). IPI human database (Version 3.87) was used as human sequence database. MS/MS peak lists were filtered to contain at most six peaks per 100 Da interval and searched against Mascot server. The MS mass tolerance was set to 7 ppm and MS/MS mass tolerance was set to 0.6 Da. Up to three missed cleavages of trypsin were allowed. Oxidized methionine and cysteine carbamido-methylation were searched as variable modifications. The modifications corresponding to arginine and lysine labeled with heavy stable isotopes were handled as fixed modifications in the Mascot search, if applicable, after identification of SILAC pairs by MaxQuant. The false positive rate was set to 1% at the peptide level, the false discovery rate was set to 1% at the protein level and the minimum required peptide length was set to six amino acids. Mass spectrometric phosphopeptide analysis The Syk band was excised, reduced, alkylated, in-gel digested with trypsin, and then extracted from the gel, as described above. The tryptic peptides were re-dissolved in 20µl

DHB solution (200mg 2,5-dihydroxybenzoic acid (Sigma, USA) in 1 ml of 80% acetonitrile, 5% trifluoroacetic acid and loaded onto a TiO2 microcolumn (GL Sciences Inc.), as described19.The columns were washed three times with 20µl DHB solution and five times with 20µl of a solution of 5% trifluoroacetic acid and 80% acetonitrile to remove non-specific binding peptides and DHB. The bound peptides were then eluted with 3 x 20µl of 0.3N NH4OH (pH > 10.5) and evaporated to dryness in a SpeedVac for further MS analysis. The LTQ-Orbitrap Velos hybrid mass spectrometer (Thermo Fisher Scientific, Waltham, USA) was used in place of LTQ-Orbitrap XL hybrid mass spectrometer. The multistage activation of neutral loss of phosphoric acid was used in all CID MS/MS events to improve the fragmentation spectra of the phosphopeptides. All MS/MS spectra were searched using MASCOT v2.2.07 against the IPI human database (Version 3.87) with the following criteria: peptide mass tolerance, 10 ppm; MS/MS ion mass tolerance, 0.6 Da; number of missed cleavages allowed, up to three. The variable modifications considered were phosphorylation of

serine,

threonine

and

tyrosine,

methionine

oxidation,

and

cysteine

carboxyamidomethylation. All phosphorylated sites were examined manually by the presence of a mass difference of 69 Da between fragment ions for phosphoserine and a difference of 83 Da for phosphothreonine (supplementary table 1, supplementary figure 1). Cell proliferation assay 5·103 FFM05 or FFM12, or 103 KG-1 cells were seeded into the wells of a 96-well plate on day zero. The cells were cultured in the respective growth media outlined above. At given time points the cells were treated using a mixture consisting of the XTT-labeling reagent and the electron coupling reagent according to the protocol of the cell proliferation kit II (Roche). Four hours later the XTT-derived signals that are proportional to the cell numbers were monitored by an Elisa-Reader (Spectra Fluor Plus, specific absorbance filter: 475nm, nonspecific absorbance filter: 660nm) (Tecan). Wells containing groth media served as background controls in all experiments. In case of AML cell/stroma co-culture experiments, wells containing stroma cells and growth media were used as background controls. In vitro kinase assays For phosphorylation the recombinant catalytic domain of Syk (Biomol, Germany) was used or Syk was purified by immunopurification as described above and resuspended in kinase buffer containing 60mM HEPES pH7.5; 5mM MgCL2; 5mM MnCL2; 3µM Na3VO4; 1.25mM DTT. Protein A/G beads only served as negative control for the immunopurification. 1.5µM biotinylated substrate peptide and 20µM ATP were added, incubated for 15min at 37°C, and the reaction was stopped by adding EDTA to a final concentration of 25mM. Peptides were immobilized

on

streptavidine-coated

96well

plates

(Millipore,

Billerica,

USA)

and

phosphorylation efficiency was determined by ELISA using 1µg/ml anti-pTyr (Millipore, Billerica, USA) and 1:1000 HRPO-conjugated anti-mouse IgG antibodies (Pierce, Rockford, USA). The mean value and standard deviation (SD) of quadruplicates was determined by calculating the difference of absorption at 405nm and background absorption at 490nm.

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)ADENYyK(A)  

pY  

491.6796  

981.345  

2  

-­‐0.003  

27.0  

 

 

                                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)ADENyYK(A)  

pY  

491.6810  

981.347  

2  

-­‐0.001  

33.0  

 

 

                                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(K)ALRADENyyK(A)  

pY,  pY  

701.7742  

1401.534  

2  

-­‐0.003  

28.2  

 

 

                             

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(K)ALRADENyYK(A)  

pY  

441.5302  

1321.569  

3  

-­‐0.002  

25.7  

 

 

                             

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)DNNGsYALCLLHEGK(V)  

pS  

857.3626  

1712.711  

2  

-­‐0.012  

43.2  

 

 

                         

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EALPmDTEVYEsPyADPEEIRPK(E)  

Mox,  pS,  pY  

952.3954  

2854.164  

3  

-­‐0.006  

34.0  

 

 

                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EALPmDTEVyESPyADPEEIRPK(E)  

Mox,  pY,  pY  

952.3952  

2854.164  

3  

-­‐0.006  

53.5  

 

 

                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EALPmDTEVyESPYADPEEIRPK(E)  

Mox,  pY  

925.7402  

2774.199  

3  

-­‐0.005  

58.6  

 

 

                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EALPmDTEVYEsPYADPEEIRPK(E)  

Mox,  pS  

925.7404  

2774.199  

3  

-­‐0.004  

61.4  

 

 

                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EALPMDTEVYESPyADPEEIRPK(E)  

pY  

920.4084  

2758.203  

3  

-­‐0.005  

72.4  

 

 

                 

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EESEQIVLIGsK(T)  

pS  

706.3378  

1410.661  

2  

-­‐0.003  

30.3  

 

 

                           

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(K)ELGSGNFGtVK(K)  

pT  

594.7671  

1187.520  

2  

-­‐0.003  

35.4  

 

 

                             

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)ELNGTyAIAGGR(T)  

pY  

651.2977  

1300.581  

2  

-­‐0.001  

53.7  

 

 

                           

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EMyDLMNLCWTYDVENRPGFAAVELR(L)  

pY  

1072.4700  

3214.388  

3  

-­‐0.008  

29.3  

 

 

               

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)EyVKQTWNLQGQALEQAIISQKPQLEK(L)  

pY  

1084.2190  

3249.635  

3  

-­‐0.009  

66.8  

 

 

             

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(K)LLTLEDKELGSGNFGtVK(K)  

pT  

667.6685  

1999.984  

3  

-­‐0.003  

43.6  

 

 

                       

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(R)QESTVSFNPyEPELAPWAADKGPQR(E)  

pY  

966.4413  

2896.302  

3  

-­‐0.005  

62.7  

 

 

               

Sequence  

Modification  

Exp.  m/z  

Exp   M.W.  

Charge  

Delta    

Mascot  Ion  score  

(K)sYSFPKPGHR(K)  

pS  

628.2836  

1254.553  

2  

-­‐0.002  

30.2  

 

 

 

!"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=[email protected]'

1?'

ABC2DEBF'

BFC2GAH'

I'

BFC2GAFC'

JK2KKG'

CE2A'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=[email protected]'

1?'

ABC2DFCI'

BFC2GAEF'

I'

BFC2GAFC'

JK2KKKI'

GF2BB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/L!M
1?'

HKC2EGD'

CKKC2AHEA'

I'

CKKC2AHFG'

JK2KKKF'

ID2CB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

@O!?P(@'

()0Q'1?'

HKE2ICKC'

CKCI2AKHD'

I'

CKCI2AKFB'

JK2KKGI'

CA2HA'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

@!"R=PO>N'

1!'

HCI2EGCG'

CKIG2AAF'

I'

CKIG2AABF'

JK2KKCF'

IC2IA'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

>###'

1?'

HDH2ICAB'

CCIF2ACHI'

I'

CCIF2ACDH'

JK2KKCI'

CK2FF'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

!?"[email protected]'

1!'

ACB2CBCF'

CIHA2HHGD'

G'

CIHA2HHAE'

JK2KKCC'

CB2FA'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

[email protected]'

1?'

ACB2CBIE'

CIHA2HHDG'

G'

CIHA2HHAE'

K2KKCD'

GG2EF'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=MN=[email protected]'

1?'

DDC2EBCB'

CGIC2HDBI'

I'

CGIC2HEKG'

JK2KKCC'

IC2H'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=MN=[email protected]'

1?'

DDC2EBIC'

CGIC2HDBD'

I'

CGIC2HEKG'

JK2KKKE'

GK2G'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

>[email protected]'

1?'

DFG2GHKI'

CGDA2DFHF'

I'

CGDA2DFHG'

K2KKKH'

GG2CE'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

!M//!>SLTN'

1?'

DFE2IBHB'

CGEI2HEEI'

I'

CGEI2HFCG'

JK2KKA'

CF2DD'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

MN>?!?'

1?'

DBB2FKEB'

CGBE2DKCI'

I'

CGBE2DKCE'

JK2KKKA'

GI2DC'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

MN>?!!'

I'1?'

EGB2EBKD'

CAEE2HDDD'

I'

CAEE2HDF'

JK2KKCG'

CK2CE'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

MN>!?!'

I'1?'

EGB2EBCC'

CAEE2HDED'

I'

CAEE2HDF'

JK2KKKG'

IC2CI'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

[email protected]"[email protected]'

1!'

ABB2HFAB'

CABH2EGIB'

G'

CABH2EGGE'

JK2KKKF'

GC2D'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

[email protected][email protected]'

1?'

ABB2HFHG'

CABH2EGAC'

G'

CABH2EGGE'

K2KKKA'

IG2FH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

[email protected]!?"[email protected]'

1!'

ABB2HFHG'

CABH2EGAC'

G'

CABH2EGGE'

K2KKKA'

GK2EB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

>!MOOS=M!L=TON'

1?'

EEC2GDEI'

CHAK2ECBF'

I'

CHAK2ECFF'

K2KKCC'

GB2IG'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=[email protected][email protected]'

1?'

HGH2HDCF'

CDKG2DDGD'

G'

CDKG2DDDF'

JK2KKGI'

IA2BA'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=[email protected][email protected]'

I'1?'

HDI2ICE'

CDFG2DIBI'

G'

CDFG2DGGC'

JK2KKGB'

IB2I'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

<>>O"?=M7MMT/[email protected]'

1!'

FHE2GDCF'

CECI2EKB'

I'

CECI2EIIB'

JK2KCGB'

AK2KG'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

UORS/MVN/[email protected]'

1?'

ECC2KIKE'

ICGK2KAKG'

G'

ICGK2KGBF'

K2KKKH'

GA2CE'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=$$O(=TMRSSSO>VUN'

1!'

EEA2KCBH'

IGCB2KGDE'

G'

IGCB2KCAA'

K2KIIG'

CC2DH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=!!O(=<"=>TMRSSSO>VUN'

()0Q'1!'

HFA2EHDH'

IGGA2BBDB'

A'

IGGH2KKBG'

JK2KCIA'

GG2H'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

=$$O(=TMRSSSO>VUN'

()0Q'1!'

EEB2GHCC'

IGGH2KGCH'

G'

IGGH2KKBG'

K2KIII'

GI2GF'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

P/!UL!S>R!/R/M=R6==<@'

1?'

CIGK2KAI'

IAHF2KDBA'

I'

IAHF2KEG'

JK2KKGH'

AF2GB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'1?'

CGFF2CKE'

IEEA2CBBA'

I'

IEEA2IKGA'

JK2KKGB'

AB2HI'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'1?'

BIH2EACA'

IEEA2IKIA'

G'

IEEA2IKGA'

JK2KKC'

GD2FH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'1!'

BIH2EAAD'

IEEA2ICI'

G'

IEEA2IKGA'

K2KKFD'

HB2CF'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

(VOV7/=/"6(ML(/(=/MORM>@'

I'()0Q'1!'

BGD2ACDD'

IFKD2IIF'

G'

IFKD2ICD'

K2KCCB'

IK2CD'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
I'1?'

BAE2KDDF'

IFGF2CEFD'

G'

IFGF2CEAF'

K2KKGF'

DC2CB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

(VOV7/=/"6(ML(/(=/MORM>@'

A'()0Q'1!'

BAE2KFCA'

IFGF2IIIA'

G'

IFGF2IKHB'

K2KCDH'

ID2CB'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'I'1?'

BHI2GBEF'

IFHA2CECD'

G'

IFHA2CDBE'

K2KKCB'

HB2AH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'1!Q'1?'

BHI2GBFH'

IFHA2CEGE'

G'

IFHA2CDBE'

K2KKA'

IC2ID'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

P/!UL!S>R!/R/M=R6==<@ORPN'

1?'

BDD2AAGC'

IFBD2GKEH'

G'

IFBD2GKDB'

K2KKKD'

FI2AH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/(?M76%?NROS==L/MN'

I'()0Q'1U'

CKFG2CGB'

GIAD2GBHI'

G'

GIAD2GFDC'

K2KKB'

AB2AH'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/[email protected]>MPOP=M/[email protected]/@'

1?'

CKFA2IIC'

GIAB2DACI'

G'

GIAB2DAGA'

JK2KKIG'

AH2AG'

' ' ' ' ' ' ' ' '

'

!"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

@!"R=PO>N'

1!'

HCI2EGCG'

CKIG2AAF'

I'

CKIG2AABF'

JK2KKCF'

GH2HC'

'

' !"#$"%&"'

()*+,+&-.+)%'

/012'345'

/012'(262'

78-9:"'

7-;2'(262'

<";.-'

!&)9"'

/=MR(
()0Q'I'1?'

BHI2GBED'

IFHA2CEC'

G'

IFHA2CDBE'

K2KKCG'

DK2AC'

' '

Supplementary figure 1 Annotated ESI-MSMS spectra of phosphorylated tryptic peptides derived from Syk. Annotated Mascot MSMS spectra of phosphopeptides are shown and the corresponding assigned fragment ions. The table above the spectra lists the m/z values of the precursor ions, the charge state, the corresponding MW, the mass deviation, the peptide score (in MASCOT), the confirmed phosphorylation site, the identified sequence and the modification(s) of the sequenced peptide. Spectra were recorded on an Orbitrap MS (Thermo Fisher Scientific). The precursor in MS showed a mass accuracy of ! 2 ppm. At least one MSMS spectrum is shown for each p-site.'

Supplementary figure 2 Growth curves of KG-1-, FFM05- and FFM12 cells that were left untreated/DMSO treated (black lines) or were treated (A) with the Src kinase inhibitor pp2 at a final concentration of 1µM (grey lines) or (B) with Dasatinib at a final concentration of 4nM (grey lines). Proliferation was monitored by an XTT-based assay as outlined in the Methods section.

 

  Supplementary figure 3 (A) Schematic representation of the FGFR1OP2-FGFR1 fusion protein. (B) RT-PCR of the fusion region of the FGFR1OP2-FGFR1 fusion protein. The following primers were used: forward ATCAGTCGGCCTTGGAACTTA, reverse AGAAGAACCCCAGAGTTCATG (C) 48 hours after silencing of FGFR1, KG-1 cells were harvested and lysed. The respective lysates were subjected to immunoblot analysis using antibodies against FGFR1, pSTAT3, pSTAT5, pSyk and actin. (D) Growth curve of KG-1 cells that were treated with shRNAs against FGFR1 (grey line) or the respective control shRNAs (black line). Proliferation was monitored by an XTT-based assay.

 

UPN

Age

AML sec. to

WBC x 109/L (% blasts)

Karyotype

FFM05

60

MDS

2 (7%)

At onset: 4445,XY,t(1;3)(q4 2;q27), del(5)(q14q33)7,del(16)(q23),+ MAI1,+Mar2

BM: 25%

FFM12

24

-

7 (22%)

45,XX,-7[12]; 46,XX[8]

Molecular-genetic findings None (No FLT3-ITD mutations, no FLT3-kinase domain mutations, no Kit mutations) AML1/ETO; NRAS (No FLT3-ITD mutations, no FLT3-kinase domain mutations, no Kit mutations)

Risk group HR

HR

Supplementary table 1: Primary AML patient characteristics. Primary AML cells of two patients were purified and cultured as outlined in the Material and Methods section and the respective primary AML cell lines are denominated as FFM05 and FFM12. Enlisted are the results of the cytogenetic and molecular-genetic analyses, the age of the patients, the initial white blood count (WBC) and the respective risk groups.

 

AML-specific p-sites

B cell-specific p-sites

S3/4 S9 Y389 S443 T610 -

Y28 S44 T256 S306 S316 T317 S319 S379 T384 T530 S579 T582

Supplementary table 3: Cell type-specific phosphorylation patterns. P-sites that were identified in AML cells and were not reported to be phosphorylated in B cells are outlined in the left column. P-sites that were previously identified in B cell antigen receptor stimulated B cells but not in AML cells are listed in the right column26.