MATERIALS AND METHODS

Materials and methods 36 MATERIALS AND ... one transit peptide and one mature portions from ... Chloroplasts collected from one tenth aliquot of the a...

0 downloads 233 Views 49KB Size
Materials and methods

MATERIALS AND METHODS 1. Materials 1.1. Bacterial strains E.coli strains DH5α (Hanahan, 1983) was used for cloning. Protein overexpression was carried out in E.coli strain BL21 (DE3) (Studier and Moffat, 1986). 1.2. Vectors The following vectors were used for the cloning and transcription: pBluescript II KS(Stratagene, San Diego), pGEM-T easy (Promega), pBAT (Annweiler et al., 1991). Protein overexpression in E. coli was performed in pAR3040 (Rosenberg et al., 1987). 1.3. Plasmids For cloning and mutagenesis of genes and protein expression, as well as protein import experiments, a collection of plasmids available from the precious work in our laboratory has been used. These plasmids contain cDNA sequences encoding either the authentic precursors of various polypeptides of chloroplast, or the cassettes encoding fusion proteins composed of one transit peptide and one mature portions from different precursor proteins. These plasmids have been described previously () and, if desirable, are specified in detail in the text. 1.4. Plant materials Pea (Pisum sativum) seedings were grown in green house at 25 °C with long day light (10 hours per day), and harvested on the 7th-10th day after sowing. Arabidopsis thaliana plants were grown on sterile SM medium at 20 °C with short day light (8 hours per day). For preparing DNA or RNA samples, Arabidopsis seedlings were harvested at two weeks after germination. For preparing chloroplasts from Arabidopsis leaves, plants were harvested at four to six weeks after germination. 1.5. Chemicals and other materials All chemicals were purchased from the following companies: Sigma-Aldrich Chemie (Deisenhofen), Roth GmbH & Co. (Karlsruhe), Serva Feinbiochemica (Heidelberg), Merck AG (Darmstadt), Fluka (Neu-Ulm). If not mentioned, all chemicals used were of analytical grade. Crosslinkers were obtained form Pierce Biotechnology (Rockford, IL). The Talon metal-chelate affinity matrix was obtained from Clontech (Palo Alto, CA). Protein A-Sepharose was from Amersham Biosciences (Amersham-Pharmacia) (Freiburg). 36

Materials and methods Nitrocellulose membranes were obtained from Schleicher & Schuell (Dassel), and polyvinylidenfluorid (PVDF) transfermembranes were from Millipore Corporation (Bedford, MA). Secondary antibodies were obtained from Sigma. DNA molecular weight standard used was 1 kb Ladder from Gibco BRL (Eggenstein). Protein molecular mass standards for SDS protein electrophoresis were obtained from Sigma, which consist of a mixture of 7 proteins: lysozyme (14.3 kDa), soybean trypsin inhibitor (20.1 kDa), trypsiongen (24 kDa), carboanhydrase (29 kDa), glyceraldehyde-3-phosphate dehydrogenase (36 kDa), ovalbumin (45 kDa) and bovine serum albumine (66 kDa). Protein Markers used for non-denaturing protein electrophoresis were also from Sigma, and consist of BSA (66-190 kDa), beta-amylase (200 kDa), and thyroglobulin (667 kDa). Radiochemicals were purchased from Amersham Biosciences and ICN Biomedicals GmbH (Mechenheim). 1.6. Oligonucleotides Oligonucleotides used for polymerase chain reaction (PCR) and mutagenesis were synthesized by Metabion GmbH (Planegg-Martinsried). For cloning TAT genes of Arabidopsis thaliana or Pisum sativum Arab.TatC forward: TCATATGAGCAGCACAAGCACTAG Aarb.TatC reverse: GGATCCTCACCGACCTGTGAGCTTG PeaTatA forward: CATATGGAGATAACACTTTCCATTTC PeaTatA reverse: GATATCTACAATATCCTTTGTGCTGG PeaTatB forward: CATATGACACCATCTCTGGCAATTG PeaTatB reverse: CCCGGGCATTAAATCCGAAGGTAACGACG PeaTatC forward: CATATGGGTTTGGGAACCACCACTG PeaTatC reverse: CCCGGGTCCCCGTCCAGCGAGTTTGACCATC For 16/23 deletion mutagenesis: 23k DC84: TGGATCCTTAACCACCCTCAGAATCAG 23k DC128: CGGATCCTTAATTGCTGGTGGCATCAA 23k C-term151: GGATATCCCAAGCAAAGAGAAAGAG 23k C-term119: GGATATCAAGAAATCCATCACAGAC 23k 84EcoRV: CGATATCACCACCCTCAGAATCAGTC 23k 128EcoRV: CGATATCATTGCTGGTGGCATCAAAG 23k C151EcorV: CGATATCGTTCCATTTTGAAGGTAC

37

Materials and methods 1.7. Enzymes Molecular biology enzymes were purchased from: Roche Diagnostics GmbH (Mannheim), MBI Fermentas (Vilnius, Lithuania), New England Biolabs (Schwalgach), Stratagene (La Jolla, CA) and USB (Cleveland, OH). Proteases and protease inhibitors were from Sigma. RNase inhibitors was from MBI Fermentas. 2. Methods 2.1. Standard methods Basic molecular procedures have been carried out as described by Samvrook et al. (1989). Plasmid DNA was isolated by alkaline lysis procedure (Birnboim and Doly, (1979). DNA sequencing was performed either by using the dideoxynucleotide chain termination method (Sanger et al., 1977) or by using ABI method. 2.2. Transcription and translation To produce analytical amounts of radioactively labelled proteins, in vitro transcription and translation of cDNA clones encoding original, chimeric or mutant proteins available from the pervious work and obtained in this study were performed. 2.2.1. In vitro transcription Transcription of cDNAs was performed from gene cassettes cloned in either pBluescript KS or in pBAT vectors. The plasmid DNAs were firstly linerarized downstream of the gene sequence by proper restriction enzymes, then the linerarized plasmid DNAs were subjected for transcription reactions, using either T3 or T7 RNA polymerase in accordance to the recommendations of manufacturers (Stratagene and New England Biolabs, respectively). Composition of the in vitro transcription reaction was as follows:

H2O 5 x reaction buffer 2.5mM rNTP mixture (GTP: 0.25mM) 100mM DTT 5mM m7GpppG (capping nucleotide) 40 U/µl RNase inhibitor linerarized plasmid DANN (2 µg) RNA polymerase (40U/µl) total volume

6.5 µl 5 µl 5 µl 2.5 µl 2.5 µl 0.5 µl 2.5 µl 0.5 µl 25 µl 38

Materials and methods The reaction mixture was pre-incubated at 37°C for 30 min to allow the formation of the cap structure. Incubation was continued for additional 1 h at 37°C after adding 1 µl of 11.25mM rGTP to the reaction, then the reaction was terminated by addition of 100 µl ice-cold DEPCtreated H2O. The synthesized RNAs were precipitated by addition of 0.1 volume of 4 M NH4Ac and 3 volumes of EtOH. RNA-ethanol suspension can be stored at -20°C for years. RNAs were collected by centrifugation at 15,000 rpm for 30 min prior to using for in vitro translation. 2.2.2. In vitro translation Synthesis of radioactively labelled proteins was performed by in vitro translation of mRNA obtained from in vitro transcription in the presence of 35 [S]-methionine or 3[H]-leucine (Amersham) using an either wheat germ extract- or reticulocyte lysate-based cell-free translation system. 35 3 [S]-Met [H]-Leu DEPC-H2O 4.65 µl 3.15 µl 1 M KCl 0.6 µl 0.6 µl Amino acids mixture (-Met) 0.25 µl -Amino acids mixture (-Leu) -0.25 µl 100 mM DTT 0.25 µl 0.25 µl 35 S-Met 0.5 µl -3 H-Leu -2 µl reticulocyte lysate 6.25 µl 6.25 µl total

12.5 µl

12.5 µl

The reaction was carried out for 60-90 min at 30°C, then the resulting in vitro translation products were used for import experiments directly or stored at –80 °C for up to one week.

2.3. Isolation of the chloroplast from pea leaves Green house-grown pea seedlings were harvested at the 7-10 days after germination; the leaves were homogenized in 400 ml of ice-cold SIM using either a Waring Blendor. Homogenate was filtered through two layers of Miracloth and centrifuged in a Serva SLC250T rotor for 2 min at 4,000 rpm. The crude chloroplast pellet was resuspended with ca. 8 ml of SRM and loaded onto a 35% Percoll cushion. After centrifugation for 7 min at 4,000 rpm in a Serva SL-50T rotor, the pellet of intact chloroplasts was washed twice with 1 x SRM, and the chloroplasts were collected by centrifugation for 2 min at 3,000 rpm in a SL-50T rotor. The chloroplasts were finally resuspended in 2 ml 1x SRM. The concentration of the chloroplast resuspension was defined by its chlorophyll concentration. Chlorophyll was extracted from 10 µl of the chloroplast resuspension with 1 ml 39

Materials and methods acetone, and the solution was subjected to a Schimadzu spectrophotometer. The total concentration of chlorophyll a and b was obtained according to the formula (Arnon, 1949): C(a+b)=A663 x 8.02 + A645 x 20.2

1 x SIM Hepes/KOH, pH 7,6 EDTA Sucrose

25 mM 2 mM 350 mM

35% Percoll solution 5 x SRM Percoll H2O HM buffer Hepes/KOH, pH 8.0 MgCl2

2 ml 3,5 ml 4,5 ml 10 mM 5 mM

2.4. Import of protein into intact chloroplasts The standard in organello import reaction:

chloroplasts 250 mM methionine 100 mM Mg-ATP 1 M MgCl2 in vitro translation reaction 1 x SRM

Volume equal to 60 µg chlorophyll 3 µl 12 µl 1.5 µl 12.5 µl to 150 µl

Final concentration 5 mM 2 mM 10 mM

Complete assays without in vitro translation were briefly preincubated at 25 °C, and the import reactions were initiated by addition of in vitro translation and carried out for 30 min at 25 °C in the light. After incubation, samples were transferred into ice and diluted with 350 µl of ice-cold 1x SRM buffer. Chloroplasts were collected from a 50 µl aliquot of the sample by centrifugation at 6,000 rpm for 3 minutes, and denatured with 2 x Laemmli buffer (Cfraction). Chloroplasts collected from the rest of the sample were resuspended in 1x SRM containing 100 µg/ml thermolysin, and the reaction mixture was chased on ice for 20 min to remove the envelope-bound radioactive protein. Thermolysin treatment was terminated by addition of EDTA to 25 mM. Chloroplasts collected from one tenth aliquot of the assay were denatured with 2 x Laemmli buffer (C+ fraction), and the rest of the chloroplasts were reisolated by centrifugation through a 35% Percoll cushion at 8,000rpm for 8 min. The intact 40

Materials and methods plastids were thoroughly washed with 1 ml of 1 x SRM buffer, with EDTA added to 10 mM, and collected by centrifugation for 1 min at 6,000 rpm. Stroma and thylakoid fractions were separated by osmotically lysing chloroplasts in 100 µl of HM buffer containing 10 mM EDTA for 5 min, followed by centrifugation at 10,000 rpm for 5 min. Stromal proteins in the supernatant were precipitated with equal volume of 4 x Laemmli buffer (S fraction). Thylakoid membranes were washed with HM buffer and resuspended in 200 µl of the same buffer. One half of the thylakoids were mock-treated directly (T- fraction), and the other half was treated with 150 µg/ml thermolysin for 30 min on ice to remove proteins exposed at the surface of the thylakoid membrane. The thermolysin treatment was terminated by addition of EDTA to 10 mM, and the resulted thylakoids were collected by centrifugation at 10,000 rpm for 3 min followed by denaturing with 2 x Laemmli (T+ fraction). Protein samples were analyzed by SDS-PAGE and autoradiography.

2.5. Import experiments with isolated thylakoids. In thylakoido import experiments were generally carried out using thylakoids obtained from pea chloroplasts. To isolate thylakoid, chloroplasts were lyzed in HM buffer at a concentration of 0.75 mg/ml chlorophyll for 5 min on ice and then centrifuged for 5 min at 10,000 rpm at 4 °C. The supernatant containing stroma was separated from thylakoid pellets, collected and stored on ice. Thylakoids were washed twice with the HM buffer by centrifugation (5 min, 10,000 rpm) and finally resuspended either in HM buffer or in stroma fraction at a chlorophyll concentration of 0.75 mg/ml. The standard in thylakoido import assay included: thylakoid suspension in vitro translation product HM buffer Total volume

40 µl 5 µl 5 µl 50 µl

Routinely, thylakoid import reactions were incubated for 30 min at 25 °C in the light. The resulting thylakoid vesicles were re-isolated by centrifugation for 5 min at 10,000 rpm at 4 °C and washed once with HM buffer. Then, half of the thylakoid vesicles were resuspended in 2x Laemmli sample buffer, while the second half were resuspended in HM buffer containing 150 µg/ml thermolysin. After incubation for 30 min on ice, protease treatment was terminated by addition of HME (10 mM Hepes/KOH, pH 8.0, 5 mM MgCl2, 10 mM EDTA) buffer. Thylakoids were collected by centrifugation at 10,000 rpm for 5 min and resuspended in 2x Laemmli sample buffer. After denaturation by heating for 3 min at 100 °C, samples were analyzed by gel electrophoresis followed by radiography.

41

Materials and methods To examine the influence of inhibitors on the thylakoid translocation of proteins, assays were supplemented with nigericin (to 2 µM) or sodium azide (10 µM). To examine the role of NTPs, apyrase was added (1 U per 50 µl Assay). Competitor proteins were added to the concentration indicated in the respective assays.

Modifications 1, protein import into thylakoids extracted with chaotropic salts and alkaline solutions In order the function of thylakoid membrane proteins in protein translocation, thylakoid vesicles were pre-treated with solutions of chaotropic salts and alkaline solutions to remove certain thylakoid membrane proteins. In these assays, thylakoids were resuspended at 0.5 mg/ml of chlorophyll in HS buffer (10 mM Hepes, pH 8.0, 5 mM MgCl2, sucrose 100 mM) containing 2 M NaBr, 2M NaSCN, 0.1 M Na2CO3, 0.1 M NaOH. After incubation on ice for 30 min, thylakoids were reisolated by centrifugation at 10,000 rpm for 5 min and washed three times with HS buffer. The resulting thylakoids were resuspended at 0.75 mg/ml of chlorophyll in HM buffer and subjected to import assays. One fraction of the thylakoids were mock-treated, and the remained proteins were separated by SDS-PAGE and analyzed by Western blot using antisera against certain thylakoid proteins. 2, protease pre-treatment assays Protease protection studies with thylakoids were carried out in order to characterize the degree to which different polypeptides are exposed on the stromal surface of thylakoid membrane. Thylakoids were resuspended at 0.5 mg/ml of chlorophyll in HM buffer. This suspension was divided into aliquots which were incubated with the following proteases: thermolysin (100 µg/ml; CaCl 2 was added to 5 mM), trypsin (100 µg/ml), and proteinase K (150 µg/ml), or without any additions either for 20 min at 20 °C or for 30 min on ice. Subsequently, thylakoids were diluted with 1 ml of an ice –cold HM buffer, and appropriate protease inhibitors were added: EDTA for thermolysin (to 20 mM), Soybean trypsin inhibitor for trypsin (to 50 µg/ml) and PMSF for proteinase K (to 2 mM). Thylakoids were collected by centrifugation for 10 min at 30,000 g, washed once with HM buffer containing corresponding protease inhibitors, and finally resuspended in the same buffer before subjecting to import experiment. One fraction of the thylakoid membranes were mock-treated, and proteins remained in the thylakoid membranes were separated by SDS-PAGE followed by Western hybridization. 3, import with the immune-pretreated pea thylakoids Pea thylakoids obtained from lysis of the chloroplasts were resuspended in 20mM Hepes/KOH, pH8.0, 10mM MgCl2 , 1% BSA at the concentration of 0.5 µg/µl chlorophyll. The corresponding antibody IgG was added to a final concentration of 0.5 µg/µl, or as 42

Materials and methods described in the text. Binding of the IgG to the thylakoid membrane was carried out at 4°C for 40 mins with agitation, and the resulting thylakoids were reisolated and washed with 10mM Hepes/KOH, pH8.0, 10mM MgCl2 to get rid of the unbound IgG. Finally, thylakoids were resuspended in HM buffer or in stroma at the concentration of 0.75 µg/µl chlorophyll, and subsequently used for in thylakoido import assays as described above. 2.6. Electrophoresis of proteins 2.6.1. SDS polyacrylamide gel electrophoresis Polyacrylamide gel electrophoresis of SDS-denatured proteins was performed according to the description of Laemmli (Laemmli 1970). As a rule, polyacrylamide gels with an acrylamide gradient from 10-17.5% were used except being mentioned. Composition of a 1017.5 % gel is shown below.

H2O 1 M Tris-HCl (pH 6.8) 2 M Tris-HCl (pH 8.8) 80% sucrose 30% AA 10% SDS 10% APS TEMED Total volume

stacking gel 13.9 ml 2.5 ml --3.34 ml 200 µl 160 µl 16 µl 20 ml

10% 15.4 ml -7.5 ml 2.4 ml 14.3 ml 0.4 ml 160 µl 16 µl 40 ml

17,5% 0 -7.5 ml 8.8 ml 23.3 ml 0.4 ml 160 µl 16 µl 40 ml

Electrophoresis was performed overnight at approx. 25 mA, maximal power 160-180 V. 30% acrylamide stock

acrylamide N,N´-methylenebisacrylamide H2O

1 x Laemmli running buffer

Tris glycine SDS

292 g 8g ad to 1000 ml 25 mM 195 mM 0.1%

2.6.2. Non-denaturing electrophoresis of membrane proteins (blue native electrophoresis) Separation of membrane polypeptides under non-denaturing conditions presents an inherently complex problem as these proteins are prone to aggregation and frequently require different conditions for their optimal recovery from the membrane. For the isolation of photosynthetic 43

Materials and methods complexes of the membrane, the blue native gel electrophoresis introduced by Schägger and von Jagow(1991) was modified. With these alterations, the method reproducibly allowed high-resolution separation of the principal oligomeric complexes of the thylakoid membrane. A typical separation of thylakoid protein complexes is shown below. Preparation of samples Lysis buffer: Stock solutions 0.5 M Bistris, pH7,0 2M ε-aminocaproic acid 0.5 M EDTA, pH 8.0 0.1 M MgCl2 0.1 M PMSF (in isopropanol) 0.1 M DTT H2 O

Volume 500 µl 2500 µl 50 µl 25 µl 50µl 50 µl ad 5 ml

Final concentration 50 mM 1M 5 mM 0.5 mM 1 mM 1 mM

Solubilization: For solubilization of the membrane protein complexes, thylakoid membranes (equivalent to 30 µg of chlorophyll) were resuspended with 15 µl of lysis buffer and 7.5 µl of 5% digitonin. After incubation for 30-60 min at 4°C under agitation, unsolubilized membrane material was spun down at 40,000 g for 1 h. The supernatant was supplemented with 1.5 µl of 5% Coomassie Briliant Blue G-250 in lysis buffer, bound on ice for 10 min, and centrifuged at 40,000 g for 3 min. The supernatant of this centrifugation was used for loading onto the gel. Electrophoresis Gel solutions: Stock Solutions Stacking gel H2O 5,1 ml 10x Bistris (0,5M, pH 7,0) 1,0 ml 30% acrylamide/bisacrylamide 1,3 ml 2M 2-aminocaproic acid 2,5 ml 87,5% glycerol -5% digitonin 60 µl 10% APS 90 µl TEMED 9 µl total volume 10 ml

5% 7,43 ml 2,27 ml 3,85 ml 5,68 ml 1,23 ml 136 µl 88 µl 8,8 µl 20,8 ml

13,5% 1,38 ml 1,5 ml 6,75 ml 3,75 ml 1,5 ml 90 µl 46 µl 4,6 µl 15 ml

10% 3,08 ml 1,5 ml 5 ml 3,75 ml 1,5 ml 90 µl 50 µl 5 µl 15 ml

10x running buffer: 0.5M tricine, 0.15 M Bistris, pH 7,0

44

Materials and methods Protein samples were resolved at approx. 10 mA ( with power restricted at 280 V) at 4°C. 1x running buffer contained 0,0075% of coomassie G250. The extent of separation of most photosynthetic complexes could be significantly improved by using Bistris-propane buffer instead of Bistris in all solutions. For the isolation of the photosynthetic complexes of thylakoid membrane, colored bands corresponding to distinct multimeric complexes were cut out of the gel and, after equilibration with and SDS-containing buffer, resolved in the second dimension under denaturing conditions. Detection of proteins in these gels was performed by either silver staining or radio- and fluorography. Native gel equilibration: Equilibration buffer:

Tris Glycine ß-mercaptoethanol SDS

25 mM 192 mM 140 mM 1%

Incubate Blue-native gel in the equilibration buffer at 50°C for 5-10 min to denature the proteins. 2.7. Staining of proteins For detection of protein bands on gels, staining with Coomassie Brilliant Blue R-250 was routinely used (following standard procedures). To increase the sensitivity of detection, the proteins were stained with silver essentially following the method of Heukeshoven and Dernick (1988). SDS-PAGE gels were fixed overnight in fixing solution, and subsequently equilibrated with 50% ethanol 3 time for 20 min with agitation. Gels were swelled in 0.02% Na2S2O3x5H2O, and then washed 3 times for 20 sec with H2O bidistil. Gels were then stained in silver nitrate solution for 20 min. After washing 2 times with water, stained proteins bands were visualized by development in developing solution until an appropriate pattern was achieved. Development was terminated by transferring the gels into stop solution. Before being dried, gels were washed to remove acetic acid in 50% methanol for at least 30 minutes. fixing solution

methanol acetic acid formaldehyde 37% H2O bidist.

50 ml 12 ml 50 µl ad 100 ml

silver nitrate solution

AgNO3 formaldehyde 37% H2O bidist.

0.2 g 75 µl ad 100 ml 45

Materials and methods developing solution

Na2CO3 Formaldehyde 37% Na2S2O3x5H2O 0.2% H2O bidist.

60 g 50 µl 20 µl ad 100 ml

stop solution

methanol Acetic acid H2O bidist.

50 ml 12 ml ad 100 ml

2.8. Immunodetection of proteins – Western blot For detection of proteins using specific antisera, proteins were firstly blotted onto the Immobilon-P membrane (PVDF membrane) purchased from Millipore. Right after electrophoresis, gels were incubated in transfer buffer (150 mM glycine, 20 mM Tris, 10% methanol). Electrophorestic transfer was performed in a semi-dry transfer apparatus (GibcoBRL) with transfer buffer. Prehybridization, hybridization with primary and secondary antisera were carried out in 1 x PBS containing 1% v/v Tween 20 and 5% dry skimmed milk. Specific antisera were used usually in a 1:1,000 dilution. Secondary antisera conjugated to horseradish peroxidase were used in a 1:30,000 dilution. After the hybridization with the secondary antisera, the PVDF membranes were washed three times with 1 xPBS containing 0.1% v/v Tween 20. For visualization of protein bands, the secondary antibodies were developed with ECL (enhanced chemiluminescence) reaction (Voelker and Barkan 1995). The developing reagent was set up before the reaction freshly from stock solution. After incubation for 1 min in the developing reagent, PVDF membranes were wrapped in plastic foil and exposed to an X-ray film for an appropriate time. 10 x PBS

ECL reagent

NaCl KCl Na2HPO4 KH2PO4

750 mM 30 mM 45 mM 5 mM

stock solution volume 1 M Tris-HCl, pH 8.5 500 µl 250 mM luminol (in DMSO) 50 µl 90 mM p-coumaric acid (in DMSO) 22 µl 3 µl 30% H2O2 H2O bidist. Ad to 10 ml

concentration 50 mM 1.25 mM 200 µM 2.7 mM

2.9. Coimmunoprecipitation under non-denaturing conditions Washed thylakoid membranes (30µg chlorophyll) were solubilized in 100 µl resuspension buffer with digitonin (50 mM Hepes/KOH, pH 7.0, 150 mM KAc, 0.05% BSA, 1 mM PMSF, and 1% digitonin). After incubation for 30 min at 4 °C with agitation, the solubilized 46

Materials and methods membrane material was gained from the 40,000 g supernatant, and was mixed with 1-5 µg IgG. 20 µl of 10% protein A–Sepharose CL4B (Pharmacia) was then added to the mixture, and the suspension was incubated for 1 h at 4°C with agitation. The unbound proteins were recovered by centrifugation for 5 min at 10,000 rpm, and the protein A–Sepharose beads were washed with resuspension buffer described above except containing only 0.1% digitonin. Bound proteins were recovered by incubating the beads in 7 M urea, 2% SDS, 100 mM TrisHCl, pH 6.8, 5% 2-mercaptoethanol, 0.1% bromophenol blue for 10 min at room temperature followed by centrifugation. Protein samples were separated by SDS-PAGE followed by autoradiography. 2.10. Ion-exchange chromatography Isolated thylakoid membranes (equal to 150 µg chlorophyll) were resuspended in 400 µl solubilization buffer (20 mM Hepes/KOH, pH 7.6, 10 mM MgCl2, 5 mM EDTA, 0.5 mM PMSF). After addition of 100 µl 5% digitonin, the solubilization was performed at 4 °C for 60 min. The non-solubilized material was removed by sediment at 40,000 g for 40 min. The supernatant was transferred to a cold room and subjected to a 1 ml DEAE-sepharose column equilibrated with solubilization buffer containing 0.1% digitonin. The column was washed subsequently with 2 ml of solubilization buffer with 0.1 % digitonin and 0 mM (NH4)2SO4, 10 mM (NH4)2SO4, 40 mM (NH4)2SO4, 0.2 M (NH4)2SO4, and 1 M (NH4)2SO4. The elution was collected in 500 µl fraction, and proteins were precipitated with 10% TCA. After centrifugation at 15,000 rpm for 30 min, the protein pellets were dissolved in 2 x Laemmli buffer and subjected to SDS-PAGE. Proteins of each fraction were analyzed by either Western hybridization or autoradiography. 2.11. Co-purification of thylakoid membrane proteins through metal affinity chromatography Thylakoid membranes (equal to 50 µg chlorophyll) were re-isolated after performance of import with 10 µg of overexpressed 16/23His protein and washed three times with HM buffer to remove the non-imported 16/23His. Thylakoid membranes were resuspended in 200 µl of phosphate buffer, then digitonin was added to 1%. After centrifugation at 40,000 g for 1 hour, the supernatant was applied to an equilibrated 0.5 ml TALON metal affinity resine (Clontech, San Jose, CA, USA) column. The unbound proteins were washed subsequently with 10 ml of phosphate buffer and washing buffer, and the bound proteins were eluted with 2 ml of elution buffer. Proteins in each fraction were precipitated with 10% TCA and collected by centrifugation at 15,000 rpm for 30 min. The protein pellets were dissolved in 2 x Laemmli buffer and subjected to SDS-PAGE followed by Western analysis with different specific antisera. Phosphate buffer (pH 7.5)

Na2HPO4 NaH2PO4 NaCl

58 mM 17 mM 68 mM 47

Materials and methods

Equilibration buffer (pH 8.0)

Washing buffer (pH 7.0)

Elution buffer (pH 7.0)

PMSF sodium phosphate NaCl PMSF sodium phosphate NaCl Imidazole PMSF sodium phosphate NaCl Imidazole PMSF

1 mM 50 mM 300 mM 1 mM 50 mM 300 mM 10 mM 1 mM 50 mM 300 mM 150 mM 1 mM

2.12. In vitro integration of protein into phospholipid membrane The solid supported lipid membrane TRANSIL (NIMBUS Biotechnologie GmbH, Leipzig) was used to examine the membrane-insertion potential of proteins. TRANSIL consists of porous silica beads each completely coated with a single phospholipid bilayer containing POPG (1-Palmitoyl-2-Olenyl-sn-Glycero-3-Phosphoglycerol)/egg PC (phosphatidylcholine). POPG was present with a concentration of 0%, 5% and 20%, respectively. Before subjected to integration assays, TRANSIL beads were washed with HM buffer and resuspended at 5% in HM buffer. In vitro translated radioactive proteins were incubated with TRANSIL beads with agitation for 30 min at room temperature to allow the insertion of the proteins into phospholipid membrane. The resulting beads were collected at 10,000 rpm for 5 min and subsequently washed for three times with HM buffer. One half of the beads were mocktreated, while the other half were resuspended in HM buffer containing 100 µg/ml thermolysin or given proteases. After protease treatment, the beads were collected again and mock-treated. Protein samples were analyzed by SDS-PAGE and autoradiography. 2.13. Screening of peptide libraries on continuous cellulose membrane supports The solid phase-bound chemical peptide libraries represented the TAT proteins were synthesized by the group of Prof. G. Fischer (Max-Plank Research Unit for Enzymology of Protein Folding, Halle). These libraries have been used for the detection of epitopes which act as binding sites for the substrate proteins or the TAT components themselves. Screening of the peptide libraries was performed according to the description of Kramer and SchneiderMergener (1995) with minor modifications. Cellulose membranes were rinse with a little volume of methanol for 1 min to avoid the precipitation of hydrophobic peptides, then the membranes were washed three times with an appropriate volume of TBS for 10 min. Membranes were incubated in blocking buffer overnight (about 14 hours) at room temperature with shaking, then the blocking buffer was removed by washing the membrane three times with T-TBS buffer. Membranes were incubated in ligand solutions containing 48

Materials and methods either in vitro translated proteins or overexpressed proteins for three hours, followed by three times washing with T-TBS buffer. Proteins binding on the libraries were transferred to a new nitrocellulose membrane. Radio-labelled proteins were visualized by autoradiography, whereas the overexpressed protein were detected by Western blot using specific antibodies. TBS

Tris-(hydroxymethyl)-aminomethan Adjust pH to 8.0 with HCl NaCl KCl

50 mM 137 mM 2.7 mM

blocking buffer

BSA sucrose TBS

5% (w/v) 5% (w/v) 1x

T-TBS

Tween 20 TBS

0.5% (v/v) 1x

Ligand solutiong

BSA sucrose Tween 20 TBS in vitro translation overexpressed protein total volume

5% (w/v) 5% (w/v) 0.5% (v/v) 1x 50 µl 0.1 µg/ml 50 ml

Regeneration of cellulose bound peptide libraries After probing, the cellulose peptide libraries can be regenerated using the following procedure. Membranes were washed three times with water for 10 min, followed by three times washing with DMF for 10 min. After removal of DMF by rinsing the membranes with water, the membranes were subsequently incubated three times in regeneration buffer A and three times in regeneration buffer B. After washing twice with methanol for 10 min, the membranes could be reprobed with different ligands. regeneration buffer A

urea SDS β-mercaptoethanol H2 O

480.5 g 10 g 1 ml ad to 1 l

regeneration buffer B

ethanol acetic acid H2 O

500 ml 100 ml ad to 1 l 49