2 Materials and methods

2 Materials and methods 14 ... After an initial denaturation step at 95°C for 2 min, ... To prevent degradation of primers and template...

0 downloads 169 Views 397KB Size
2 Materials and methods

2

14

Materials and methods

2.1 2.1.1

Materials Plasmids

pGEM-T vector

Promega, Heidelberg, Germany

pGL3-promoter vector

Promega, Heidelberg, Germany

pRL-null vector

Promega, Heidelberg, Germany

2.1.2

Antibodies

Acetyl-H3 antibodies

Biomol, Hamburg, Germany

H3-trimethyl lysine 9 antibodies

Abcam, Cambridge, UK

Sp1 antibodies

Santa Cruz Biotechnology, Inc., Santa Cruz, Calif., USA

XPA antibodies

Santa Cruz Biotechnology, Inc., Santa Cruz, Calif., USA

2.1.3

Biological materials

Human MTC Panel I

Clontech Laboratories, Inc., USA

TOP 10F’ E. coli competent cells

Clontech Laboratories, Inc., USA

Total RNA of normal mammary gland

BD Biosciences, Erembodegem, Belgium

2.1.4

Cell medium

DMEM 1x

Biochrom AG, Berlin, Germany

Fetal calf serum

Biochrom AG, Berlin, Germany

Epith-o-ser

C-C-Pro, Neustadt, Germany

Mammary epithelial cell growth medium

MEGM; PromoCell, Heidelberg, Germany

Opti-MeM I Reduced Serum Medium

Invitrogen, Groningen, Netherlands

RPMI 1640 with glutamine

Biochrom AG, Berlin, Germany

2.1.5

Enzymes

Alkaline phosphatase, Shrimp

Roche Diagnostic GmbH, Mannheim, Germany

Proteinase K

Promega, Heidelberg, Germany

RNAsin, RNAse inhibitor

Promega, Heidelberg, Germany

Restriction enzymes

New England BioLabs, Beverly, USA

2 Materials and methods

15

SssI methylase

New England BioLabs, Beverly, USA

T4 DNA ligase

Promega, Heidelberg, Germany

T4 polynucleotide kinase

New England BioLabs, Beverly, USA

α

Roche Diagnostic GmbH, Mannheim, Germany

Taq I

2.1.6

Equipment

Ultrasound homogenizator, Sonicator, Bandelin Sonopuls HD2070

Bandelin Electronics, Berlin, Germany

UV spectrometer, GeneQuant pro RNA/DNA Calculator

Amersham Biosciences, Freiburg, Germany

Hybridizer HB-1D

Techne Inc., Duxford, Cambridge, USA

LightCycler “Rotor Gene 2000”

Corbett Research, Sydney, Australia

Gel Dryer, Model 583

BioRad, Muenchen, Germany

Model SA gel electrophoresis unit

Invitrogen, Groningen, Netherlands

Nylon membrane, Hybond N+

Amersham Biosciences, Freiburg, Germany

PCR cycler – Perkin Elmer DNA thermal cycler (for radioactive labelling)

Perkin Elmer, Norwalk, USA

Thermocycler, Mastercycler gradient

Eppendorf, Hamburg, Germany

Power supply, Powerpak 200

BioRad, Muenchen, Germany

Power supply, Powerpak 3000

BioRad, Muenchen, Germany

Electroblotter, the Panther Semidry Electroblotter HEP3

PeqLab- Owl Separation Systems, Biotechnologie GmbH, Erlangen, Germany

UV Stratalinker 1800

Stratagene, La Jolla, CA, USA

Vacuum concentrator, model 5301

Eppendorf, Hamburg, Germany

Phosphoimager, Storm 860

Molecular Dynamics, Inc., Sannyvale, CA, USA

2.1.7

Kits

Dual-Luciferase Reporter Assay system

Promega, Heidelberg, Germany

iScript cDNA Synthesis kit

Bio-Rad, Muenchen, Germany

QIAamp DNA kit

Qiagen, Hilden, Germany

QIAfilter plasmid Maxiprep kit

Qiagen, Hilden, Germany

QIAprep spin kit

Qiagen, Hilden, Germany

QIAquick Gel Extraction kit

Qiagen, Hilden, Germany

QuickChange XL Site-Directed Mutagenesis kit

Stratagene, La Jolla, CA, USA

2 Materials and methods Wizard DNA Clean-Up system 2.1.8

16 Promega, Heidelberg, Germany

Polymerases

Exo¯ Pfu DNA polymerase

Stratagene, La Jolla, CA, USA

Expand Long Template PCR system

Roche Diagnostic GmbH, Mannheim, Germany

Fast Taq polymerase

Roche Diagnostic GmbH, Mannheim, Germany

Taq polymerase, Invitaq

InViTek, Berlin, Germany

2.1.9

Reagents

[α-32P CTP]

MP Biomedicals, Co., Irvine, Ca, USA

[γ-32 P ATP]

MP Biomedicals, Co., Irvine, Ca, USA

2-mercaptoethanol

Sigma, Deisenhofen, Germany

5-Aza-CdR

Sigma, Deisenhofen, Germany

Ammonium acetate

Merck, Darmstadt; Germany

ATP, lithium salt

Roche Diagnostic GmbH, Mannheim, Germany

Betain

Sigma, Deisenhofen, Germany

Boric acid

Roth, Karlsruhe, Germany

Bromphenol blue

Merck, Darmstadt; Germany

BSA

Roth, Karlsruhe, Germany

Chloroform

Roth, Karlsruhe, Germany

Deoxycholate

Sigma, Deisenhofen, Germany

Dimethyl sulfate

Fluka Biochemica, Ulm, Germany

dNTPS

InViTek, Berlin, Germany

DTT

Roth, Karlsruhe, Germany

EDTA

Roth, Karlsruhe, Germany

Ethanol 96% Ficoll-Plague

Merck, Darmstadt; Germany TM

Plus

Amersham Pharmacia Biotech AG, Uppsala, Sweden

Formaldehyde 37%

Roth, Karlsruhe, Germany

Formamide 99%

Serva Electrophoresis GmbH, Heidelberg, Germany

Formic acid 95%

Sigma, Deisenhofen, Germany

Glycogen

Roche Diagnostic GmbH, Mannheim, Germany

Hydrazine (64%)

Sigma, Deisenhofen, Germany

2 Materials and methods

17

Hydroquinone

Sigma, Deisenhofen, Germany

Interleukin-2 for cell cultures

Pharma Biotechnologie Hannover, Hannover, Germany

KCl

Merck, Darmstadt, Germany

LiCl

Sigma, Deisenhofen, Germany

Lipofectamine 2000

Invitrogen, Groningen, Netherlands

MgCl2

InViTek, Berlin, Germany

Na-cacodylate

Sigma, Deisenhofen, Germany

NaOH

Merck, Darmstadt, Germany

NP-40

Fluka Biochemica, Ulm, Germany

PBS 1x

Invitrogen, Groningen, Netherlands

Phenol

Merck, Darmstadt; Germany

Phytohemagglutinin

Biochrom AG, Berlin, Germany

Penicillin/streptomycin

Biochrom AG, Berlin, Germany

Piperidine 99%

Sigma, Deisenhofen, Germany

PMSF

Sigma, Deisenhofen, Germany

Protease inhibitor coctail tablets, Complete Mini

Roche Diagnostic GmbH, Mannheim, Germany

S-adenosylmethionine

New England BioLabs, Beverly, USA

Salmon sperm DNA/protein A agarose

Upstate, Charlottesville, USA

Salmon Sperm DNA

Sigma, Deisenhofen, Germany

SDS

Roth, Karlsruhe, Germany

Sephadex G-50

Pharmacia Biotech AB, Uppsala, Sweden

Sodium acetate

Merck, Darmstadt; Germany

Sodium bisulfite

Sigma, Deisenhofen, Germany

Sucrose

Merck, Darmstadt; Germany

SybrTM Green I

BioWhittaker, Belgium

TBE 1x

100 mM tris, 100 mM boric acid, 2 mM EDTA pH 8.0

Tris

Invitrogen, Groningen, Netherlands

Triton X-100

Roth, Karlsruhe, Germany

Trizol reagent

Invitrogen, Groningen, Netherlands

tRNA E.coli

Roche Diagnostic GmbH, Mannheim, Germany

Urea

Roth, Karlsruhe, Germany

Water, Ampuwa

Fresenius Kabi, Bad Homburg, Germany

Xylene cyanole

Merck, Darmstadt, Germany

2 Materials and methods

18

2.1.10 Cell cultures Four breast cancer cell lines (T47D, MDA-MB-231, MCF7 and ZR75-1), HeLa S3 and the A549 lung cancer cell line were obtained from American Type Culture Collection and cultured in the recommended medium. Human mammary epithelial cells (HMEC184 and HMEC-48R) were obtained from reduction mammoplasty and provided by Martha Stampfer (Lawrence Berkeley Laboratories, Berkeley CA, USA). Additional mammary epithelial cells (HMEC-219 and HMEC-1001) were purchased from Clonetics (Clonetics, BioWhittaker, Verviers, Belgium) or isolated from normal mammary epithelium (NME), which was obtained from healthy women of the Universtätsfrauenklinik Halle by reduction mammoplasty and cultivated in epith-o-ser up to a passage 4 (HMEC-141). Clonetics cell lines (HMEC-219 and HMEC-1001) were available only at post-stasis stadium and sub-cultured until they reached agonescence. HMECs were cultivated in serum free mammary epithelial cell growth medium (Epith-o-ser) to no more than 80% confluence. Cells were grown at 37°C in 5% CO2 and medium was changed every 3 days. To determine the population doublings, the cells were counted at each passage.

2.1.11 Cultivation of the peripheral blood mononuclear cells (PBMC) For cultivation, mononuclear cells from blood were isolated from healthy person according to the following protocol. Blood was collected using syringe containing Liheparin (Sarstedt AG & Co., Nümbrecht, Germany). Five ml of blood was diluted with 5 ml of RPMI medium. Further, 10 ml of blood mix was overlayered onto 3 ml FicollPlagueTM Plus and spun without a brake for 30 min at 1400 rpm at 10°C. Interphase containing PBMC was collected and washed twice with PBS. Isolated cells were incubated for 5 h at 37°C in 5% CO2 in RPMI medium supplemented with 10% fetal calf serum, 100 units/ml penicillin and 100 µg/ml streptomycin. Further, the nonadherent cells were transferred into new flask and cultivated in RPMI medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin and 4.8 µg/ml phytohemagglutinin at 37°C in 5% CO2. Separation of adherent cells from non-adherent cells was performed to remove monocytes; therefore cultivated cells were mainly lymphocytes. After 72 h, medium was changed to RPMI supplemented with 10% fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin and 25 units/ml interleukin-2. After 4 days of cell incubation at 37°C in

2 Materials and methods

19

5% CO2, cells were spun for 5 min at 1500 rpm at RT, washed with PBS and used for DNA and RNA isolations.

2.1.12 Oligonucleotides All primers were generated by Oligo 4.0 software (National Bioscience, Inc. Plymouth, USA) and produced desalted by Invitrogen (Invitrogen, Groningen, Netherlands). Linker primers for LM-PCR were produced and purified by high pressure liquid chromatography by Qiagen (Qiagen, Hilden, Germany).

2 Materials and methods

2.2 2.2.1

20

Methods Treatment of cells with 5-aza-2’-deoxycytidine (5-Aza-CdR)

For expressional analysis by RT-PCR (see below chapters 2.2.8 and 2.2.9), cells of HMEC-184 passage 13 and the breast carcinomas (T47D, MDA-MB-231, MCF7 and ZR75-1) were grown for 4 days in the presence or absence of 10 µM 5-Aza-CdR.

2.2.2

DNA isolation from tissues and cultured cells

Genomic DNA was extracted according to Sambrook and colleagues (Sambrook et al., 1989). Briefly, DNA was isolated by cell lysis with Proteinase K (0.375 mg/ml) digestion at 55°C for 6 – 8 h and by extraction with phenol/chloroform. After precipitation with EtOH, DNA was dissolved in H2O and quantified by UV spectrometry.

2.2.3

DNA isolation from blood

DNA from blood was isolated using QIAamp DNA kit according to the manufacturer's instructions (Qiagen), eluated with water and quantified by UV spectrometry.

2.2.4

In vitro methylation of the HeLa DNA

For in vitro methylation, 20 µg of the HeLa DNA was treated with 60 units of SssI methylase (New England BioLabs) at 37°C in 200 µl of reaction mix containing 160 µM S-adenosylmethionine. After 4 h of incubation, an S-adenosylmethionine was added to a final concentration of 320 µM and the incubation was continued overnight. Further, the DNA was purified with phenol/chloroform, precipitated and dissolved at 1 µg/µl in H2O.

2.2.5

Bisulfite treatment of the DNA

Bisulfite treatment of the DNA was carried out according to the protocol of Clark and colleagues (Clark et al., 1994). Two µg of genomic DNA was denatured by adding NaOH to a final concentration of 0.3 M and incubating at 37°C for 15 min. Sodium bisulfite, to a final concentration of 3.2 M, and hydroquinone, to a final concentration

2 Materials and methods

21

of 0.5mM, were added to the denaturated DNA; samples were carefully mixed and incubated at 55°C for 16 h. The modified DNA was purified through the Wizard DNA Clean-Up system (Promega). NaOH, to a final concentration of 0.3 M, was added and DNA was incubated for 10 min at 37°C. After adding of 2 µg of glycogen and one volume of 7.5 M ammonium acetate, the bisulfite-treated DNA was precipitated and dissolved in 100 µl of H2O.

2.2.6

Methylation specific PCR (MSP)

DNA methylation pattern of the p16 CpG island was determined by MSP using primers pairs p16-M and p16-U (Table 2-1) and the conditions as described by Herman and colleagues (Herman et al., 1996). Briefly, 100 ng of bisulfite-treated genomic DNA was amplified in 25 µl of reaction volume using the following final concentrations: 1x Taq buffer, 2 units of Taq polymerase (InViTek), 0.2 mM dNTPs, 1.5 mM MgCl2, 4% formamide and 10 pmoles of specific primers to methylated or unmethylated DNA (Table 2-1). After an initial denaturation step at 95°C for 2 min, the cycling conditions were as follows: 92°C for 30 s, annealing temperature (Tan) (Table 2-1) for 30 s and 72°C for 30 s for 40 cycles. The last elongation step was performed at 72°C for 5 min. To prevent degradation of primers and template by

3' 5'

exonuclease

activity

of

(http://www1.qiagen.com/products/pcr/

Taq

polymerase

at

proofstartsystem

low

temperature

/default.aspx),

the

polymerase was added to PCR mix at 65°C (Hot Start). PCR products were resolved on a 2% TBE agarose gel.

Table 2-1. P16 gene: primers and PCR conditions for MSP Primers (5’→3’)

1

Tan, ºC

Size of PCR product, bp

P16-M1

U: TTATTAGAGGGTGGGGCGGATCGC L: GACCCCGAACCGCGACCGTAA

65

150

P16-U2

U: TTATTAGAGGGTGGGGTGGATTGT L: CAACCCCAAACCACAACCATAA

60

148

Primer pair for amplification of the methylated DNA. 2Primer pair for amplification of the unmethylated DNA.

2 Materials and methods 2.2.7

Methylation analysis of the RASSF1 locus

2.2.7.1

BLU

5 5

6.1 6

22

Combined bisulfite restriction analysis (COBRA)

6.2 7

7 8

98

9 10

10 11

11 12

CpG Taqa I

HTH HpyCH4IV

HT

T

RASSF1A 1α 1α CpG island A

T TT

HH

T H

MER1

H

Alu

T

LINE2

T

H

Alu

HH T

1β 1β

TH H T

2αβ 2αβ

T H TTT

RASSF1C

2γ 2γ CpG island C

H

HH T T

HT T

BstU I

U4

0

200bp

U3

500bp

U2

U1

RA

D1

D2

D3

4 D4

5 D5

6 D6

C RC

1kb

Figure 2-1. Map of the RASSF1 locus. The arrows indicate the transcriptional start sites of the RASSF1 isoforms. The RASSF1 and BLU exons are marked by the green and blue boxes, respectively. Red boxes represent the RASSF1A and RASSF1C CpG islands. The localizations of the CpG islands were determined by CpGplot (http://www.ebi.ac.uk). Obs/Exp. sets the minimum average observed to expected ratio of C plus G to CpG in a set of 10 windows that are required before a CpG island is reported. Additional DNA elements (Alu, MER1 and LINE2) were located by RepeatMasker (ftp.genome.washington.edu/RM/RepeatMasker.html) and marked by white boxes. CpGs are marked by bars. The coding DNA strand was deaminated in silicio. The indicated 12 PCR fragments (yellow boxes) of the 7 kb locus were analyzed by COBRA. The restriction cutting sites of CpG containing sequence are shown (HpyCH4IV, TaqαI and BstUI).

The DNA methylation status of the RASSF1 locus was determined by COBRA (Xiong and Laird, 1997). For this analysis, the primers for 12 fragments (U4, U3, U2, U1, RA, D1, D2, D3, D4, D5 and D6) of the RASSF1 locus were generated (Figure 2-1 and Table 2-2). For the first PCR of COBRA, 100 ng of bisulfite-treated genomic DNA was amplified in 25 µl of the reaction volume using the following final concentrations: 1x Taq buffer, 2 units of Taq polymerase (InViTek), 0.2 mM dNTPs, 1.5 mM MgCl2, formamide (Table 2-2) and 10 pmoles of each primer (Table 2-2). After an initial denaturation step at 95°C for 5 min, the cycling conditions were as follows: 95°C for 20 s, Tan (Table 2-2) for 30 s and 72°C for 50 s (number of cycles is shown in Table 2-2). The final elongation step was performed at 72°C for 5 min. For the nested PCR of COBRA, 5 µl of the first PCR products was amplified in 50 µl of the reaction volume using the following final concentrations: 1x Taq buffer, 4 units of Taq polymerase (InViTek), 0.2 mM dNTPs, 1.5 mM MgCl2, formamide (Table 2-2) and 10 pmoles of each primer (Table 2-2). After an initial denaturation step at 95°C for 5 min, the cycling conditions were as follows: 95°C for 20 s, Tan (Table 2-2) for 30 s and 72°C for 40 s (number of cycles is shown in Table 2-2). The final elongation step was performed at 72°C for 5 min.

2 Materials and methods

23

Twenty to fifty ng of the nested PCR products was digested with 2 units of restriction enzyme in 10 µl of reaction mix as described in Table 2-2. PCR product of in vitro methylated HeLa DNA was used as a control for complete digestion. The restriction products were resolved on a 2% TBE - agarose gel and analyzed by ImageJ 1.28V software (NIH, USA).

2.2.7.2 Bisulfite sequencing Amplified bisulfite PCR products were subcloned into the pGEM-T vector according to the manufacturer's instructions (Promega). Briefly, 2 µl of PCR products was ligated with 25 ng of pGEM-T vector using 1.5 units of T4 DNA ligase (Promega) in 10 µl of reaction mix for 4 h at RT. After ligation, the DNA was transformed in TOP 10F’ E. coli competent cells according to the manufacturer's instructions (Clontech). After “Blue/White” screening, the plasmid DNA from 5 white clones was isolated by the QIAprep spin kit (Qiagen) and sequenced by automated DNA sequencers (SeqLab, Göttingen, Germany) using T7B (5’ TAATACGACTCACTATAGGG) and M13RL (5’ GGAAACAGCTATGACCATGAT) primers.

2.2.8

RNA isolation and reverse transcription

Total RNA was extracted from cells using the Trizol reagent according to the manufacturer's instructions (Invitrogen), dissolved in water solution of RNAsin (1u/µl) and quantified by UV spectrometry. cDNA was synthesized from 0.5 µg of RNA using the iScript cDNA Synthesis kit (BioRad) in a total volume of 20 µl which consisted of 4 µl of 5x iScript reaction mixture, 1 µl of reverse transcription mix and RNA in a nuclease-free water. cDNA synthesis conditions were as follows: 5 min at 25°C, 30 min at 42°C, 5 min at 85°C. For real time PCR experiments, ready cDNA was diluted thrice in water. For expression analysis in normal human mammary gland, total RNA from this tissue was obtained from Clontech. To analyze gene expression in different human tissues (heart, whole brain, placenta, lung, liver, skeletal muscle and kidney), ready cDNA from the Human MTC panel I was utilized (Clontech).

Table 2-2. COBRA: PCR and restriction conditions First PCR Primers (5’→3’)

Nested PCR Primer (5’→3’)

Tan, ºC (cycles1; FA2,%)

RC D6 D5 D4 D3 D2 D1 RA U1 U2 U3 U4 1

CU

GTTTTTTGTGGTAGGTGGGGTTTG

CL

AATCCRAATCCTCTTAACTACAATAACCAC

5U

GGGGTGAGAATGGAGAATGGAATAT

5L

AAAACCACAAACAAAAAAACCTACTCAAC

5U

GGGGTGAGAATGGAGAATGGAATAT

5L

AAAACCACAAACAAAAAAACCTACTCAAC

4U

GTGAGGTTGAAGAAAAGGGAATTAAATTT

4L

CCCCCTACAACTCCTACTCAACTCCTT

2U

TTTTTTTTGATTTAGTGAATTAGATGTTAAA

2L

CTATATTCAAACAATTCTCCCACCTCA

2U

TTTTTTTTGATTTAGTGAATTAGATGTTAAA

2L

CTATATTCAAACAATTCTCCCACCTCA

1U

GAGGGGAAGGGGTAGTTAAGGGGTA

1L

TTCCCTTCACCCTAAAAATTCTAAAAAA

AU

GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT

AL

ACCCTCTTCCTCTAACACAATAAAACTAACC

u1U

TGGGAAAAGTATGGAAAGATTTGTGTT

u1L

TACTAAAAAAAAAAAATCCCCACATCC

u2U

TGGTTTATTTGTAGAGTTTTTTGGTTTATTTG

u2L

CCACCCACATCCATACCTCCTCCTACA

u3U

GTGTGTTGGTTTTTTTTTTTAGGTAAGTTG

u3L

AAAATACCTATAAAAACCCATATCCCACTAA

u4U

GTGAATATTGTGTGATTTTTTAGGAGTTGTA

u4L

AATAAAAAAAAACCCTACCTCCTTCCC 2

57 (25; 0) 57 (25; 2) 57 (25; 2)

CU2

GGTGGGGTTTGTGAGTGGAGTTT

CL2

ACTACTCRTCRTACTACTCCAAATCATTTC

5U

GGGGTGAGAATGGAGAATGGAATAT

6L2

CCAAACTAATCTCAAACTCCTAATCTCA

5U2

GGGTGGATTATTTGAGATTAGGAGTTT

5L

Restriction Size ,

Restriction

(cycles1; FA2,%)

bp

enzyme

57 (40; 0)

311

Hpy CH4

4, 66, 117, 124

57 (40; 2)

282

Bstu I

142, 184

55 (40; 2)

368

Hpy CH4

58, 106, 204

245

Hpy CH4

49, 196

57 (40; 2)

256

Taqα I

48, 208

56 (40; 2)

380

Hpy CH4

39, 341

54 (40; 2)

185

Bstu I

12, 32, 72, 79

54 (40; 6)

184

Taqα I

21, 82, 92

57 (35; 2)

237

Taqα I

27, 55, 122

59 (40; 2)

254

Bstu I

33, 221

57 (35; 2)

331

Tan, ºC

54 (20; 2) 57 (25; 2) 55 (20; 0) 57 (25; 2) 59 (25; 2) 58 (25; 2) 56 (25; 2)

Number of cycles. Formamide concentration in PCR mix. 3Size of PCR product

3U2

GGGGGGAGTATAAAGTTGTGATAGAAT

2L

CTATATTCAAACAATTCTCCCACCTCA

2U

TTTTTTTTGATTTAGTGAATTAGATGTTAAA

2L2

CCCCCCAACTAAATTTATAATATCCTC

1U2

GGAAGGGGTAGTTAAGGGGTAG

1L2

AACAACCACCTCTACTCATCTATAACCC

AU

GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT

AL2

CCCCACAATCCCTACACCCAAAT

u12

TAAATGAGGGTTGTAGTTGTTGAGGGT

u1L2

TAAAACAACACACTTAACCTACCCACTAAA

u2U2

GAAGGATTTGGTGTTGGAATAGGTAGG

u2L2

CCTCCCTACCATTTCCACAAACCT

u3U

GTGTGTTGGTTTTTTTTTTTAGGTAAGTTG

u3L2

ATCACCTAAAACCCAAAAACTAAAAAAAA

u4U2

TTGATGGAATTTGAGATTGTATTGAAGG

u4L

Product

AAAACCACAAACAAAAAAACCTACTCAAC

58 (36; 2) 54 (20; 2)

3

AATAAAAAAAAACCCTACCTCCTTCCC

57 (35; 2)

283

Bstu I

151, 180

Taqα I

37, 79, 215

Hpy CH4

41, 132, 110

Taqα I

77, 206

24

2 Materials and methods

2.2.9

25

Quantification of transcription level by real time RT-PCR

2.2.9.1

Real time PCR

Real time PCR was carried out in a LightCycler “Rotor Gene 2000” using SybrTM green I detection. Reactions were set up in 25 µl of volume using the following final concentrations: 1x Taq buffer (1.5 mM MgCl2), 1 unit of Fast Taq polymerase (Roche), 0.25 mM dNTPs each, 10 pmoles of each primer (Table 2-3), 0.2x SybrTM Green I (BioWhittaker), formamide (Table 2-3) and 2 µl of cDNA. After an initial denaturation step at 95°C for 5 min, the cycling conditions were as follows: 95°C for 20 s, Tan (Table 2-3) for 30 s, 72°C for 30 s and a fluorescence measurement after 15 s of the appropriate measurement temperature (Tm) (Table 2-3) for 50 cycles. The final elongation step was performed at 72°C for 5 min. The melting temperature of the PCR products were analyzed by a fluorescence measurement at every 1°C step after 5 s from 70°C up to 99°C. All measurements were independently repeated three times with several cDNA preparations. The amplification of PCR products was verified using melting curve option and subsequent gel electrophoresis using 2% TBE agarose gel.

Table 2-3. RT-PCR: Primers and conditions.

1

Primers (5’→3’)

Tan, ºC

Tm, ºC

FA1, %

Size of PCR product, bp

RASSF1A

U: GGCTGGGAACCCGCGGTG L: TCCTGCAAGGAGGGTGGCTTCT

60

83

2

239

RASSF1C

U: AGCTCGAGCAGTACTTCACCGC L: TCCTGCAAGGAGGGTGGCTTCT

64

83

2

261

p16

U: GCTGCCCAACGCACCGAATAGT L: CTCCCGGGCAGCGTCGTG

60

88

2

157

Formamide concentration.

Data analysis was performed by Rotor Gene Software version 4.6 using comparative method (see chapter 2.2.9.3). In experiments with cDNA from different tissues, the RASSF1A and RASSF1C expression levels were plotted relative to the transcription levels in the pancreas (=100%). For analysis of the RASSF1A and RASSF1C expressions in PBMC, HeLa, HF, mammary gland, HMECs and breast cancer cell lines, the expression levels were plotted relative to transcription levels in HF (=100%). To verify the RASSF1A and RASSF1C expressions in HMEC-184 after 5-Aza-CdR

2 Materials and methods

26

treatment, the expression levels were plotted relative to transcription level in untreated cells (=100%). For analysis of the p16INK4 transcription in HeLa, HF, HMECs, A549, T47D, ZR75-1, MCF7 and MDA-MB-231, the expression levels of p16

INK4

were

plotted relative to expression levels in HeLa (=100%).

2.2.9.2 Analysis of melting curve Real time PCR method is based on the quantification of DNA amount at every cycle. A special fluorophor SybrTM green I is utilized for this analysis. SybrTM green I is sensitive to low amount of DNA in contrast to ethidium bromide (Schneeberger et al., 1995). The fluorescence of double stranded DNA and SybrTM green I is at least eleven folds higher than with single stranded DNA (Zipper et al., 2004).

Figure 2-2. Melting data of double stranded DNA. Melting data of a sample (blue line) and of a non template control (pink line) are present as a first derivation of fluorescence level (dF/dT) versus temperature. The peaks of the graph represent the melting temperature of probes. The optimal temperature for the fluorescence measurement of the specific PCR product is indicated.

In real time PCR experiments with SybrTM green I, the measurement of DNA amount is performed after every elongation step at specific temperature for every primer pair. This temperature is determined using melting curve analysis (Figure 2-2). To perform this analysis, the fluorescence measurement of PCR products at every 1°C step after 5 s from 70°C up to 99°C takes place as a last step of real time PCR. Further, these raw data are presented as the first derivation of fluorescence level (dF/dT) versus temperature (Figure 2-2) (Rotor Gene Software version 4.6). The peaks of this derivation present temperature when maximal changing of fluorescence occurs during melting (Figure 2-2). Using this derivation, it is possible to identify the temperature

2 Materials and methods

27

(Tm) when primer dimers are already melting and PCR products are double stranded (Figure 2-2). At this Tm, the amount of DNA is measured at every cycle of PCR.

2.2.9.3 Comparative method Comparative quantification of gene expression was performed using the Rotor Gene Software version 4.6 in comparative quantification mode. This quantification is a real time PCR analysis technique, which allows the estimation of relative expressions of genes without requiring a standard curve (Herrmann and Corbett_Research, 2002). Comparative quantitation is used to compare a certain sample to any other in the same experiment (Rotor Gene Software version 4.6). The method evaluates the amplification of each sample, and then calculates an average with error coefficient. The average of the amplification is required to compare the reaction of samples by analysis the relative Take-Off points of each sample (Herrmann and Corbett_Research, 2002). To calculate the Take-off point, the second derivative of the raw data of fluorescence measurements at every cycle is taken (Rotor Gene Software version 4.6) (Figure 2-3). A peak of this derivative is a time point when the reaction increases most rapidly. The peak occurs shortly after Take-off of the reaction (Figure 2-3). The Take-Off is the last point before which the fluorescence signal emerges from the background (Herrmann and Corbett_Research, 2002). In different experiments, different probes were used as standard reaction and the DNA (cDNA) amount in these samples were defined as 100%. The comparative concentrations were calculated only for probes with amplification rate from 1.6 up to 2.0. Variabilities of reactions were about 5%.

dF2/d2C 0.02 0.01 0 -0.01 -0.02 -0.03

5

10

15

20

25

30

35

40

cycle

Figure 2-3. The second derivative of the raw data. Lines on the graph are the second derivative of the raw data of the reactions with cDNA of HF (pink), HMEC-48R p15 (green) and HMEC-48R p16 (violet). The peaks of this function determinate a time when reaction increases most rapidly. Take-off reactions are 23.2 for HF and 28.4 for 48R p16, 31.1 for 48R p17.

2 Materials and methods

28

2.2.10 Luciferase assay 2.2.10.1 Amplification of the RASSF1A and RASSF1C promoter fragments To clone fragments of the RASSF1A and RASSF1C promoters (Figure 2-4), 50 ng of the human fibroblasts genomic DNA was amplified in 50 µl of reaction volume using the following final concentrations: 1x Taq buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 1.5 M betain and 3.75 units of proof reading Taq polymerase from Expand Long Template PCR system (Roche) and 20 pmoles of each primers (Table 2-4). After an initial denaturation step at 94°C for 2 min, the cycling conditions were as follows: 94°C for 20 s, Tan (Table 2-4) for 30 s and 68°C for 2 min for 30 cycles. The final elongation step was at 68°C for 7 min. All primers harbored a new EcoRI site (5’GAATTC) (Table 2-4).

BLU

A

10 11

RASSF1A 11 12

0

200bp 200bp

500bp 500bp

MER1

1α 1α CpG island A

CpG

Putative translation start site Sp1/Ex

-495

Exon 1α -197

PSP1U

748 bp

Sp1/L

511 bp

PSP1U

Su/Ex

-137 PSU

Su/L

0 200bp

500bp



2αβ

B CpG

CF

PSU

PSL

+17

PEXL

PSL

RASSF1C 2γ CpG island C

-529 URCEA

PEXL

391 bp 154 bp

+254

+1 530bp

LRCEA

Figure 2-4. Amplification of fragments of the RASSF1A and RASSF1C promoters. A. A map of the RASSF1A promoter region is shown. For further details see Figure 2-1. The four DNA fragments of the RASSF1A CpG island were amplified using several primer combinations (Table 2-4). Green line indicates a sequence of the exon 1α. The red line represents a sequence of the RASSF1A CpG island fragment located upstream from the putative translation start. Blue line shows a sequence of the putative RASSF1A promoter fragment located upstream from the RASSF1A CpG island. B. A map of the RASSF1C promoter region is shown. DNA fragment of the RASSF1C CpG island was amplified using URCEA and LRCEA primers (Table 2-4). Green line indicates a sequence of the exon 2γ of RASSF1C. Red line represents a sequence the RASSF1C CpG island fragment located upstream from the putative RASSF1C translation start.

2 Materials and methods

29

Table 2-4. Conditions for amplification of the RASSF1A and RASSF1C promoter fragments Primers

Tan, ºC

PCR/fragment1

Primers (5’→3’)

Sp1/L

PSP1U+ PSL

64

535/512 bp

Sp1/Ex

PSP1U+ PEXL

64

772/749 bp

Su/L

PSU+ PEXL

64

178/154 bp

PSP1U:GAATTC2ATTAATTGGAGAGCAGAGCGGGCGGTA PSU:GAATTC2ATTAATCGCGGCTCTCCTCAGCTCCTTC PSL:GAATTC2ACCGGT3TCAGGCTCCCCCGACATGGC PEXL:GAATTC2ACCGGT3TCACGCGCGCACTGCAGGC

Su/Ex

PSU+ PSL

64

415/391 bp

CF

URCEA+LRCEA

65

537/530 bp

Prom.C

Prom.A

Fragment

URCEA: GGAATTC2TCGAGGGCTGCCTGGGTG LRCEA: GGAATTC2TAGCCGTACCCGCCCGTCCC

1

Size of PCR product / size of the RASSF1 fragment in PCR product. 2EcoRI restriction site (5’GAATTC). 3AgeI restriction site (5’ACCGGT).

2.2.10.2 Cloning of the RASSF1 promoter fragments into the pGEM-T vector PCR products were gel purified using the QIAquick Gel Extraction kit (Qiagen) and cloned into the pGEM-T vector (Promega) using for transformation TOP 10F’ E. coli competent cells (Clontech). Ligation and transformation were performed according to the manufacturer's instructions (Promega, Clontech). After “Blue/White” screening, the plasmid DNA from 5 white clones was isolated by the QIAprep spin kit (Qiagen) and dissolved in 50 µl of elution buffer. To determine the presence of the PCR products in the pGEM-T vectors, 4 µl of plasmid DNA from each clone was analyzed by restriction analysis with 10 units of EcoRI (New England BioLabs) in 10 µl of reaction mix at 37ºC for 2 h. The restriction products were resolved on a 1% TBE agarose gel. The sequences of plasmids were verified (see chapter 2.2.10.3). 30 µg of the verified plasmid was treated with 80 units of EcoRI (New England BioLabs) in 100 µl of reaction mix at 37ºC for 4 h. After resolving the restriction products on a 1% TBE agarose gel, promoter fragments were isolated using the QIAquick Gel Extraction kit according to the manufacturer's instructions (Qiagen).

2.2.10.3 Sequencing DNA sequence analysis was carried out by automated DNA sequencers (SeqLab, Göttingen, Germany) using T7B and M13RL primers (see chapter 2.2.7.2).

2.2.10.4 Cloning of the RASSF1 promoter fragments in the pRL-null vector Five µl of pRL-null vector (Promega) was treated with 30 units of EcoRI (New England BioLabs) in 100 µl of reaction mix at 37ºC for 4 h. The plasmid DNA was

2 Materials and methods

30

precipitated and dissolved in 50 µl of H20. Two µl of digested DNA was used as negative control for the dephosphorylation reaction; whereas 48 µl of DNA was treated at 37ºC for 15 min with 11 units of Shrimp alkaline phosphatase (Roche) in 100 µl of reaction mix. After precipitation DNA was dissolved in 45 µl of H20 and then used for ligation. One µl of the dephosphorylated pRL-null vector was ligated with 2 µl of the EcoRI digested RASSF1 promoter fragment using 1.5 units of T4 DNA ligase (Promega) in a 10 µl reaction mix for 4 h at RT. After ligation, the DNA was transformed in TOP 10F’ E. coli competent cells according to the manufacturer's instructions (Clontech). DNA of 5 clones was isolated by the QIAprep spin kit according to the manufacturer's instructions (Qiagen), treated with diagnostic restriction enzymes to determine the orientation of the insert (Table 2-5) and analyzed by sequencing (see chapter 2.2.10.3).

Table 2-5. Analysis of orientation of the RASSF1 promoter fragments in the pRL-null vector Construct

Restriction enzyme

Right orientation1

Wrong orientation2

CF-pRLnull

XmaI

110 bp, 278 bp, 3.5 kb

156 bp, 278 bp, 3.4 kb

XhoI

53 bp, 3.8 kb

584 bp, 3.3 kb

Sp1/L-pRLnull

AgeI, HindIII

570 bp, 3.3 kb

49 bp, 3.8 kb

Sp1/Ex-pRLnull

AgeI, HindIII

807 bp, 3.3 kb

49 bp, 4 kb

Su/L-pRLnull

AgeI, HindIII

213 bp, 3.3 kb

49 bp, 3.5 kb

BamHI

1.6 kb, 1.9 kb

1.5 kb, 2 kb

AgeI, HindIII

450 bp, 3.3 kb

49 bp, 3.7 kb

BamHI

1.8 kb, 1.9 kb

1.5 kb, 2.3 kb

Su/Ex-pRLnull 1

Sizes of restriction products of constructs containing the right orientated promoter fragment. 2Sizes of restriction products of constructs containing the wrong orientated promoter fragment.

2.2.10.5 In vitro methylation of the Sp1/L-pRLnull construct Twenty µg of Sp1/L-pRLnull DNA was treated with 60 units of SssI methylase (New England BioLabs) and 160 µM S-adenosylmethionine 37°C overnight in 200 µl of reaction mix. In parallel, a mock methylation was performed with 20 µg of Sp1/LpRLnull plasmid DNA. After DNA purification with phenol/chloroform, 1 µg of glycogen was added. The DNA was precipitated and dissolved in H2O at a concentration of 1µg/µl and quantified by UV spectrometry. In the luciferase assays, expression of the in vitro methylated Sp1/L-pRLnull plasmid was compared to the mock methylated Sp1/L-pRLnull.

2 Materials and methods

31

2.2.10.6 Generation of constructs containing the mutated RASSF1A promoter

BLU 6

78

7

RASSF1A 89

910 10 11

11 12

CpG 0

Sp1/L-pRLnull

1α CpG CpGisland islandAA

MER1

Alu

Putative translation start (ATG)

200bp 500bp

-495-480

500bp 500bp

LINE2

Sp1A4

-110

-70 -55

+17

Sp1A3 Sp1A2 Sp1A1

StartA 200bp

500bp

SP1A4-Mut Putative Sp1 binding sites

Figure 2-5. Mutations of the Sp1 and translation start sites in the RASSF1A promoter. A map of the RASSF1A promoter region is shown. For further details see Figure 2-1. Constructs StartA and Sp1A4 were generated by site-directed mutagenesis of the Sp1/L-pRLnull plasmid. The crosses indicate new mutations in the putative RASSF1A translation start site and the putative Sp1 site. Yellow and green lines represent sequences of the pRL-null vector and the exon 1α of RASSF1A, respectively. Red and blue line indicate sequences of the RASSF1A CpG island fragment located upstream from the putative translation start site and the putative RASSF1A promoter fragment located upstream from the RASSF1A CpG island, respectively.

Plasmids Sp1A4-Mut and StartA were generated by the QuickChange XL SiteDirected Mutagenesis kit using the Sp1/L-pRLnull vector (Figure 2-5) with primers listed in Table 2-6 according to the manufacturer's instructions (Stratagene). After transformation and “Blue/White” screening, the plasmid DNA was isolated from 5 white clones by the QIAprep spin kit and analyzed by sequencing.

Table 2-6. Primers used for site-directed mutagenesis of the Sp1 and translation start sites in the RASSF1A promoter Construct

Original sequence→ mutated sequence

StartA

ATG → CTG

Sp1A4-Mut

GGGCGG→ AAGCGA

Primers (5’→3’) CTGMTU:CCCAACCGGGCCCTGTCGGGGGAGCC CTGMTL:GGCTCCCCCGACAGGGCCCGGTTGGG ASP1MTU:GAGAGCAGAGCAAGCGATAAAGCTGCTGAC ASP1MTL:GTCAGCAGCTTTATCGCTTGCTCTGCTCTC

2 Materials and methods

32

BLU BLU

RASSF1A

7 78

89

910 10 11

11 12

CpG 0

-495 -480 Sp1/L-pRLnull 500bp

500bp

Alu

LINE2

Putative translation start

200bp 500bp

XhoI

+17 Termination of Blu gene

Sp1A4

1kb

Sp1A3 Sp1A3 Sp1A3

-429

B 200bp

MER1 1α 1α CpG islandCpG A island A

XhoI 1kb

XhoI -315

C XhoI

XhoI

-205 -197

D XhoI

E

XhoI

XhoI

-110 -70 -55 -110 XmaI

XmaI

Figure 2-6. Deletions in the RASSF1A promoter. A map of the RASSF1A promoter region is shown. For further details see Figure 2-1. Plasmids B, C, D and E were generated by deletions in the RASSF1A promoter fragments of Sp1/L-pRLnull plasmid using XhoI and XmaI restriction sites. A red star symbols indicate the restriction sites generated by site-directed mutagenesis. Yellow and green lines represent sequences of the pRL-null vector and the exon 1 α of RASSF1A, respectively. Red and blue lines outline sequences of the RASSF1A CpG island fragment located upstream from the putative RASSF1A translation start site and the RASSF1A promoter fragment located upstream from CpG island, respectively.

To generate the B construct (Figure 2-6), 11 µg of Sp1/L-pRLnull plasmid was restricted with 30 units of XhoI enzyme (New England BioLabs) at 37ºC for 4 h. The digested DNA was resolved on a 1% TBE agarose gel and DNA fragments with 3.7 kb size were isolated from gel using the QIAquick Gel Extraction kit (Qiagen). The DNA fragments were selfligated using 1.5 units of T4 DNA ligase (Promega) in 10 µl of reaction mix for 4 h at RT. The ligated DNA was transformed in TOP 10F’ E. coli competent cells according to the manufacturer's instructions (Clontech). Plasmid DNA from two clones was isolated by the QIAprep spin kit (Qiagen) and analyzed by sequencing. To generate C, D and E (Figure 2-6) constructs, new restriction sites in Sp1/L-pRLnull plasmid were created using the QuickChange XL Site-Directed Mutagenesis kit and primers listed in Table 2-7 according to the manufacturer's instructions (Stratagene). After DNA transformation and “Blue/White” screening, the plasmid DNA from two positive clones was isolated by the QIAprep spin kit (Qiagen). Further, 5 µg of plasmid DNA was treated with 60 units of XhoI (New England BioLabs) (for the C and D constructs) or 30 units of XmaI (New England BioLabs) (for the E construct) in 100 µl of reaction mix at 37ºC for 4 h. After resolving the

2 Materials and methods

33

digested DNA on a 1% TBE agarose gel, the DNA fragments with 3.6 kb size were isolated using the QIAquick Gel Extraction kit (Qiagen). Further, the DNA fragments were selfligated using 1.5 units of T4 DNA ligase (Promega) in 10 µl of reaction mix for 4 h at RT and transformed in TOP 10F’ E. coli competent cells according to the manufacturer's instructions (Clontech). Plasmid DNA from 5 clones was isolated by the QIAprep spin kit (Qiagen). Sizes of the RASSF1A inserts in the constructs were analyzed by restriction (see Table 2-8) and sequencing analysis.

Table 2-7. Primers used for site-directed mutagenesis of the RASSF1A promoter Construct

Fragment size1

Restriction site 2

Primers (5’→3’)

enzyme

position

C

330 bp

XhoI

-315

UMXC1: GTAAAGCTGGCCTCGAG3AAACACGGGTATC LMXC1: GATACCCGTGTTTCTCGAG3GCCAGCTTTAC

D

220 bp

XhoI

-205

UMXD1: GCGGGGGGGGCTCTCGAG3AGCGCGCCCAG LMXD1: CTGGGCGCGCTCTCGAG3AGCCCCCCCCGC

E

393 bp

XmaI

-110

UMXE1: CAGCTCCTTCCCGGGCCC4AGTCTGGATCC LMXE1: GGATCCAGACTGGGCCC4GGGAAGGAGCTG

1

Size of the RASSF1A fragment in construct after deletion. 2New generated restriction site. 3XhoI restriction site (5’CTCGAG). 4 XmaI restriction site (5’GGGCCC).

Table 2-8. Restriction analysis of the C, D and E constructs

1

Construct

Restriction enzyme

Construct with deletion1

Construct without deletion2

C-pRLnull

XhoI, EcoRI

330 bp, 3.3 kb

53 bp, 63 bp, 115 bp, 330 bp, 3.3 kb

D-pRLnull

XhoI, EcoRI

220 bp, 3.3 kb

53 bp , 63 bp, 220 bp, 225 bp, 3.3 kb

E-pRLnull

PstI, EcoRI

393 bp, 3.3 kb

19 bp, 535 bp, 3.3 kb 2

Restriction products of plasmid with successfully deleted fragment. Restriction products of the mutated Sp1/LpRLnull vector without deletion.

2 Materials and methods

34

2.2.10.7 Generation of the constructs containing the mutated RASSF1C promoter

0

200bp 500bp1kb Alu Alu 1β 2αβ 1β 2αβ CpG

-526

CF-pRLnull 1kb Sp1C1

RASSF1C RASSF1C 2γ CpG island C

-772

Putative translation start

+351

-330

-270

-190

5

4

3

-50 -10 +1 2

1 1

Sp1C2

2

Sp1C3

3

Sp1C4

4

Sp1C5

5 Putative Sp1 binding sites

Figure 2-7. Mutations of the Sp1 sites in the RASSF1C promoter. A map of the RASSF1C promoter region is shown. For further details see Figure 2-1. Plasmids Sp1C1, Sp1C2, Sp1C3, Sp1C4 and Sp1C5 were generated by site-directed mutagenesis of the putative Sp1 sites in the RASSF1C promoter using the CF-pRLnull construct. The crosses indicate mutations in the putative Sp1 sites. Yellow and pink lines indicate sequences of the pRL-null and the RASSF1C CpG island fragment, respectively. Green line represents a sequence of the exon 2γ of RASSF1C.

Plasmids Sp1C1, Sp1C2, Sp1C3, Sp1C4 and Sp1C5 were generated by the QuickChange XL Site-Directed Mutagenesis kit using the CF-pRLnull construct (Figure 2-7) with primers listed in Table 2-9 according to the manufacturer's instructions (Stratagene). After transformation and “Blue/White” screening, the plasmid DNA from 5 white clones were isolated by the QIAprep spin kit (Qiagen) and analyzed by sequencing.

Table 2-9. Primers used for site-directed mutagenesis of the RASSF1C promoter Construct

Original sequence→ mutated sequence

Primers (5’→3’)

Sp1C1

CCGCCC→TCGCTT

Sp1C1U: TCCCGCACCTTCTCGCTTTCGCCTCCGGCC Sp1C1L: GGCCGGAGGCGAAAGCGAGAAGGTGCGGGA

Sp1C2

CCGCCC→TCGCTT

Sp1C2U: GGACGCTGGCACTCGCTTCCGTTCCCTGTG Sp1C2L: CACAGGGAACGGAAGCGAGAGCCAGCGTCC

Sp1C3

CCGCCC→TCGCTT

Sp1C3U: GCGTGCGTGTCCTCGCTTCGGCGTTCCTGC Sp1C3L: GCAGGAACGCCGAAGCGAGGACACGCACGC

Sp1C4

GGGCGG→AAGCGA

Sp1C4U: CGCACGCGACCGAAGCGATGGTTGGCGGCT Sp1C4L: AGCCGCCAACCATCGCTTCGGTCGCGTGCG

Sp1C5

GGGCGG→AAGCGA

Sp1C5U: GGACTGGGGGACAAGCGAGTACGGCTATGG Sp1C5L: CCATAGCCGTACTCGCTTGTCCCCCAGTCC

2 Materials and methods

35

2.2.10.8 Cell transfection and Dual - Luciferase Reporter Assay system For transfection, the plasmid DNA was isolated by the QIAfilter plasmid Maxiprep kit (Qiagen) and quantified by UV spectrometry. In 6-well plates, 3 µg of vector containing the RASSF1 promoter and 120 ng of pGL3promoter vector were co-transformed in HeLa S3 cells. To determine the background, 3 µg of pRL-null vector (Promega) and 120 ng pGL3-promoter vector (Promega) were co-transformed in cells grown in one of the wells. Lipofectamine 2000 was used for transfection according to the manufacturer's instructions (Invitrogen). After 6 h of transfection, Opti-MeM I Reduced Serum was replaced by appropriate culture medium. After 18 h, cells were washed with PBS and rocked with passive lysis buffer (Dual-Luciferase Reporter Assay system) for 15 min at RT. Expression of constructs was analyzed by Dual-Luciferase Reporter Assay system according to the manufacturer's instructions (Promega).

2.2.10.9 Analysis of Dual - Luciferase Reporter Assay data To determine the transfection efficiency, pGL3-promoter vector containing the Firefly Luciferase gene under the SV40 promoter was used for co-transfection. In every experiment, transfection of the pRL-null vector was performed to determine the Renilla Luciferase expression in a vector without insert. For every sample, reaction was performed with substrates for both luciferases, thus every sample had two raw data: A - raw data with Renilla Luciferase substrate B - raw data with Firefly Luciferase substrate = transfection efficiency Reactions with Renilla Luciferase substrate were normalized for the reaction with Firefly Luciferase substrate in the same sample by formula: C = A / B. Normalized reaction with the pRL-null vector (C0 = A0 / B0) was defined as a background and expression of vector containing the RASSF1 promoter fragment was calculated by formula: D = C - C0. Expression of one of the constructs containing the RASSF1 (A or C) promoter fragments was defined as 100% (Standard= 100%) and expression of the pRL-null vector was defined as 0% (DpRL-null=0%). On the basis of there formulas, D and the average of D with standard deviations were calculated for all samples.

2 Materials and methods

36

2.2.11 The electro mobility-shift assay (EMSA). 2.2.11.1 Isolation of nuclear extract Nuclear extract was isolated as described by Tommasi and Pfeifer with some modifications (Tommasi and Pfeifer, 1995). To isolate nuclei, HeLa S3 cells were washed twice with cold PBS and incubated in lysis buffer (10 mM hepes-KOH pH 7.9, 10 mM KCL, 0.3 M sucrose, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1 mM EGTA, 2.0 mM 2-mercaptoethanol, 0.5 mM PMSF, 1% NP-40) on ice for 20 min. The nuclei were scraped, spun for 10 min at 4000 rpm at 4ºC, transferred into Eppendorf tube and pelleted. Further, the nuclei were resuspensed and gently extracted in 2.5 volume (volume of nuclei) of cold nuclei extraction buffer (20 mM Hepes-KOH pH 7.9, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1 mM EGTA, 2.0 mM 2-mercaptoethanol, 0.5 mM PMSF, 20% Glycerol). After centrifugation for 30 min at 12000g at 4ºC, the supernatant was dialyzed against 50 volumes (volumes of supernatant) of dialysis buffer (20 mM Hepes-KOH pH 7.9, 100 mM KCL, 0.2 mM EDTA, 2.0 mM 2-mercaptoethanol, 0.5 mM PMSF, 20% glycerol) overnight at 4ºC. After measuring the protein concentration by Bradford method (Bradford, 1976), the nuclear extract was stored at -80ºC in aliquots.

2.2.11.2 Labelling of oligos Labelling of oligos was carried out as previously described by Latchman with some modifications (Latchman, 1995). Two complementary single stranded oligonucleotides (Table 2-10) with concentrations 50 pmol/µl were mixed in equimolar amounts, annealed by heating for 5 min at 80ºC and gradually cooled to RT over a period of 5 h. For labelling of double stranded oligos, reaction was set up in 20 µl of volume using the following final concentrations: 1x buffer T4 polynucleotide kinase, 100 pmol of double stranded annealed oligonucleotides, 20 µCi [γ-32 P ATP] and 10 units of T4 polynucleotide kinase (New England BioLabs). After incubation for 30 min at 37ºC and adding of 20 µg of glycogen, oligos were precipitated and dissolve in 20 µl of H2O.

2 Materials and methods

37

Table 2-10. Oligonucleotides for EMSA Upper oligo (5’→3’)

1

Lower oligo (3’→5’)

ds oligo1

AGCAGAGCGGGCGGTAAAGCTG

TCGTCTCGCCCGCCATTTCGAC

Sp1A4

AGCAGAGCGttCGGTAAAGCTG

TCGTCTCGCaaGCCATTTCGAC

Sp1A4-m

CTCCTTCCCGCCGCCCAGTCTG

GAGGAAGGGCGGCGGGTCAGAC

Sp1A3

CTCCTTCCCGttGCCCAGTCTG

GAGGAAGGGCaaCGGGTCAGAC

Sp1A3-m

GTCGGGGCCCGCCCTGTGGCCC

CAGCCCCGGGCGGGACACCGGG

Sp1A2

GTCGGGGCCCGaaCTGTGGCCC

CAGCCCCGGGCttGACACCGGG

CTGTGGCCCCGCCCGGCCCGCG

GACACCGGGGCGGGCCGGGCGC

CTGTGGCCCCGaaCGGCCCGCG

GACACCGGGGCttGCCGGGCGC

Sp1A2-m Sp1A1 Sp1A1-m

Double stranded oligonucleotides

2.2.11.3 EMSA The DNA-binding assays were carried out as described by Tommasi and Pfeifer with some modifications (Tommasi and Pfeifer, 1995). Binding reactions were set up on ice in 20 µl volume using the following final concentrations: 13 mM Hepes-KOH pH 7.9, 64 mM KCL, 0.5 mM MgCl2, 0.13 mM EDTA, 0.3 mM PMSF, 13% glycerol, 1.5 µg of Salmon sperm DNA, 2 µg of antibodies (Sp1 or XPA, both from Santa Cruz Biotechnology) and 5 µg of nuclear extract proteins. In some experiments, a 250 pmol (2500 pmol in case with SpA4) of the double stranded unlabelled oligonucleotides listed in Table 2-10 was included as competitor. After incubation of the binding mix for 10 min on ice, 2 µl of the radioactive labelled oligos was added and incubation was continued for 1 h. The DNA – protein complex was mixed with 2 µl of EMSA loading buffer (0.2% xylene cyanol, 0.2% bromophenol blue) and resolved on a 6% polyacrylamide gel in TBE 0.25x at 100 Volt for 4 h. The gel was dried under vacuum using gel dryer (BioRad) for 1 h at 80ºC and analyzed by a phosphoimaging.

2 Materials and methods

38

2.2.12 Ligation-mediated PCR (LM-PCR) LM-PCR is a method of genomic analysis to determine primary DNA nucleotide sequences, methylation patterns, DNA lesion formation and repair, and in vivo protein–DNA footprints (reviewed by Dai et al., 2000). This technique is based on the ligation of an oligonucleotide linker onto the 5’-end of each DNA molecule, where 5’-end was generated by chemical cleavage of the strand. The presence of linker on all 5’-ends allows the exponential PCR, which results in amplification of the signal. The general LM-PCR steps are outlined in Figure 2-8. LM-PCR of the cleaved DNA was performed as previously described by Dammann and Pfeifer with some modification (Dammann and Pfeifer, 1997).

A

3‘

5‘- P 3‘

DNA cleavage 5‘- P

Denature Sp1L1

3‘ 5‘

3‘

3‘ 5‘

3‘ 5‘ 11-mer

Primer „Sp1L1“ extension with Exo¯ Pfu polymerase

+ 3‘ 25-mer linker primer 3‘

Ligation of linker 3‘ Denature Sp1L2

25-mer linker primer

3‘

PCR with primer „Sp1L2“ and 25-mer linker primer 3‘

Sp1U

Sp1L3

Sequencing gel Transfer

Hybridization Sp1L3

B Sp1L2 Sp1L1

Sp1U

Figure 2-8. Outline of the ligation–mediated PCR procedure. A. LM-PCR procedure. The first step of the technique is a cleavage of the DNA. Next step is a generation of blunt end on one side using primer extension of a gene-specific oligonucleotide (primer Sp1L1). Third step is a ligation of linkers to the blunt ends. Next step is an expontial PCR amplification using the longer oligonucleotide of the linker (25-mer linker primer) and a second gene-specific primer (primer Sp1L2). After amplification, the DNA fragments were separated on the sequencing gel, electroblotted onto nylon membranes and hybridized with gene specific probe to visualize the sequence ladders. B. Arrangement of primers in a LM-PCR.

2 Materials and methods

39

2.2.12.1 In vivo footprinting using dimethyl sulfate For genomic footprinting experiments, HeLa S3 cells were treated with medium containing 0.2% dimethyl sulfate for 5 min at RT. Further, cells were washed with cold PBS, scraped, spun for 5 min at 1000 g at 4ºC and washed once more with cold PBS.

2.2.12.2 DNA isolation The following DNA isolation method was used to prevent single and double stranded DNA breaks, which can be produced by the isolation procedure. The quality of DNA, which was obtained, allows high amplification efficiencies. DNA from cells for chemical cleavage was isolated according the following procedure: 1x107 to 1x108 cells were washed with cold PBS, scraped and spun for 5 min at 1000 g at 4ºC. Cells were resuspensed in 4 ml of cold buffer A (0.3 M sucrose, 60 mM KCl, 15 mM NaCl and 2 mM EDTA pH 8.0). After adding of 4 ml of cold buffer A containing 1% NP-40, cells were incubated for 5 min on ice and spun for 5 min at 100 g at 4ºC. The nuclei pellet was washed in cold buffer A without nonindet P - 40 and resuspensed in 3 ml of buffer B (150 mM NaCl, 5 mM EDTA pH 7.8). After adding of 3 ml of buffer C (20mM tris pH 8.0, 20 mM NaCl, 20 mM EDTA pH 8.0, 1% SDS, 600 µg/ml Proteinase K), nuclei were incubated at 45ºC for 3 h. Further, DNA was extracted using phenol/chloroform, precipitated and dissolved in water.

2.2.12.3 Chemical cleavage of DNA DNA was cleaved according to the Maxam Gilbert procedure (Maxam and Gilbert, 1977). Using vacuum concentrator, 50 µg of genomic HeLa S3 DNA were dried and dissolved in water volume according to the base-specific reaction protocol. All chemical cleavages were performed on ice. G reaction: Five µl of DNA was dissolved in 200 µl of dimethyl sulfate buffer (50 mM Na-cacodylate, 1 mM EDTA pH 8.0). Further, 1 µl of dimethyl sulfate was added (99%) and DNA was incubated for 5 min at RT. The reaction was stopped by adding of 50 µl of dimethyl sulfate stop buffer (1.5 M Na-acetate pH 7.1, 1 M 2-mercaptoethanol). After adding of 100 µg of glycogen, DNA was precipitated by 750 µl of precooled 96% ethanol.

2 Materials and methods

40

G+A reaction: 25 µl of 100% formic acid was added to 11 µl of DNA and incubated for 10 min at RT. After stopping the reaction by 50 µl of dimethyl sulfate stop buffer, 5 µl of 20 mg/ml glycogen was added. DNA was precipitated with 750 µl of precooled 96% ethanol. T+C reaction: 47 µl of 64% hydrazine was added to 20 µl of DNA and incubated for 20 min at RT. After stopping the reaction by 200 µl of hydrazine stop buffer (0.3 M Na-acetate pH 7.5, 0.1 M EDTA pH 8.0), 5 µl of 20 mg/ml glycogen was added. DNA was precipitated with 750 µl of precooled 96% ethanol. C reaction: 47 µl of 64% hydrazine and 15 µl of 5 M NaCl were added to 5 µl of DNA and incubated for 20 min at RT. After stopping the reaction by 200 µl of hydrazine stop buffer, 5 µl of 20 mg/m glycogen was added. DNA was precipitated with 750 µl of precooled 96% ethanol. Samples from four reactions (G, G+A, C, T+C) were further treated together as described below. After incubation for 30 min at -70˚C, DNA was precipitated and dissolved in 225 µl of water. Further, DNA was precipitated once more and dissolved in 50 µl of water. For piperidine treatment, 50 µl of 2 M piperidine was added to DNA and incubated for 30 min at 90˚C. After cooling on ice for 5 min and adding of 40 µg of glycogen, DNA was precipitated, dried overnight in vacuum concentrator and dissolved in 50 µl of water.

2.2.12.4 Primer extension For primer extension Exo¯Pfu DNA polymerase was used (Stratagene). Reactions were set up in 30 µl of volume using the following final concentrations: 1x cloned Pfu reaction

buffer,

0.25

mM

dNTPs

each,

1

pmol

Sp1L1

primer

(5’GGAGGCCAGCTTTACTGTGCTA), 1.5 units of Exo¯ Pfu DNA polymerase, 2 µg of cleaved DNA. After an initial denaturation step at 95°C for 5 min and following annealing at 56°C for 2 min 30 s, the reaction mix was gradually heated from 57°C up to 74°C with 1°C step for 3 s. The final elongation step was done at 72°C for 15 min.

2 Materials and methods

41

2.2.12.5 Linker preparation Linker was prepared by annealing a 25-mer linker primer 20 pmol/µl (5’GCGGTGACCCGGGAGATCTGAATTC) to 11-mer linker primer 20 pmol/µl (5’GAATTCAGATC). For annealing, primer mix was heated at 95°C for 3 min and gradually cooled to RT over a period of 5 h.

2.2.12.6 Ligation 45 µl of a ligation mix ( 13.33 mM MgCl2, 30 mM DTT, 1.1 mM ATP, 16.7 mg BSA, 100 pmol linker, 50 mM tris pH 7.7, 3.25 units of T4 DNA ligase (Promega)) was added to primer extension mix on ice. After 24 h of incubation at 16°C, the ligation was stopped by heating for 10 min at 70°C and adding of 30 µl of stop-mix (7.2 M ammonium acetate, 4 mM EDTA pH 8.0, 20 µg glycogen). Ligated fragments were precipitated and dissolved in 50 µl of H20.

2.2.12.7 PCR amplification For PCR amplification, 50 µl of PCR mix (2 x Fast Taq buffer, 3 mM MgCl2, 0.5 mM dNTPs

each,

10

pmol/µl

(5’GCGGTGACCCGGGAGATCTGAATTC),

25-mer 10

pmol/µl

linker Sp1L2

primer primer

(5’TAGAGGAAGAGGGTCCCCACATCCG) and 4 units of Fast Taq polymerase (Roche)) was added to ligated fragments. After denaturation for 5 min at 95°C, the PCR cycling conditions were as follows: 95°C for 30 s, 66°C for 30 s and 72°C for 1 min for a total of 25 cycles. The last elongation step was performed for 10 min at 72°C. After amplification, 25 µl of PCR-stop mix (1.56 M sodium acetate, 60 mM EDTA pH 7.7, 10 mg tRNA) was added. The DNA was extracted using 250 µl of phenol/chloroform (92 µl phenol + 158 µl chloroform), precipitated and dissolved in 6 µl of formamide loading dye (62.6% formamide, 1.33 mM EDTA pH 7.7, 0.03% xylene cyanole, 0.03% bromphenol blue).

2.2.12.8 Gel electrophoresis and electroblotting. Three µl of PCR products was denaturated at 95°C for 3 min and separated on 8% polyacrylamide gel containing 7 M urea in TBE 1x for 4 h with the following parameters: 3000 Volt, 75 Watt, 50°C (glass temperature). Further, DNA fragments

2 Materials and methods

42

were electroblotted onto nylon membrane using electroblotter at 17 Volt and 2 Ampere for 40 min in TBE 1x.

2.2.12.9 Preparation of a single stranded PCR probe PCR products were used as a template to synthesize a single strand probe. These PCR products were generated as follow: 100 ng of genomic HeLa S3 DNA was amplified in 25 µl of reaction mix (1x Taq buffer, 2 units of Taq polymerase (InViTek), 0.2

mM

NTPs,

1.5

mM

MgCl2,

20

pmoles

(5’TAGAGGAAGAGGGTCCCCACATCCG)

of and

primers

Sp1L2 Sp1U

(5’CTGCAGTTGCTGAGGGCCGACC)). After the first denaturation for 5 min at 95°C, DNA was amplified for 40 cycles with following conditions: 95°C for 30 s, 66°C for 30 s and 72°C for 30 s. The last elongation step was performed for 10 min at 72°C. After gel purification using the QIAquick Gel Extraction kit (Qiagen), PCR products were dissolved in 30 µl of water. For probe labelling, 3 µl of PCR product was amplified in 100 µl of reaction mix (1x Taq buffer, 5 units of Taq polymerase (InViTek), 1 mM dATP, 1 mM dGTP, 1 mM dTTPs, 30 µCi [α-32P CTP], 1.5 mM MgCl2, 50 pmoles Sp1L3 primer (5’CCTGGCCCTCCTGGTCCGGTTT)). After the first denaturation for 5 min at 95°C, DNA was amplified for 30 cycles with following conditions: 95°C for 1 min, 64°C for 2 min and 72°C for 3 min. PCR products were clean from radioactive nucleotides using a Sephadex G-50 column, 400 µl of probe was used for hybridization.

2.2.12.10 UV cross linking, hybridization and exposure DNA was UV cross linked to membrane with UV Stratalinker at 1.2 mjoules after electroblotting (see chapter 2.2.12.8). The membrane was prehybridizated at 64°C for 4 h in hybridization buffer (0.25 M Na2HPO4 pH 7.2, 1 mM EDTA pH 7.7, 7% SDS, 1% BSA) and hybridized with a single stranded gene specific PCR probe overnight at 64°C. The membrane was washed twice with a 64°C warm washing buffer 1 (20 mM Na2HPO4 pH 7.2, 1mM EDTA pH 7.7, 2.5% SDS, 0.25% BSA) and twice with a 64°C warm washing buffer 2 (20 mM Na2HPO4 pH 7.2, 1 mM EDTA pH 7.7, 1% SDS). Signals were analyzed by a phosphoimaging.

2 Materials and methods

43

2.2.13 Chromatin Immunoprecipitation (ChIP) 2.2.13.1 Cell treatment and DNA shearing ChIp was performed as described in the Upstate protocol for the Chromatin Immunoprecipitation Assay kit (http://www.upstate.com/img/coa/17-295-27400.pdf) with some modifications. In order to perform ChIP analysis, histones and other proteins were crosslinked to the DNA in cells by adding formaldehyde to a final concentration of 1% to the culture medium and by incubating for 10 min at 37°C. The cells were washed twice with cold washing buffer (PBS, 1 tablet protease inhibitor cocktail pro 50 ml, 1 mM PMSF), scraped into conical tube and spun for 4 min at 2000 g at 4˚C. The cell pellet was resuspensed in a SDS lysis buffer (1% SDS, 10 mM EDTA pH 8.0, 50 mM tris pH 8.1, 1 mM PMSF, 1 tablet protease inhibitor cocktail pro 10 ml) with cell concentration of 1x106 cells pro 200 µl of SDS lysis buffer and incubated for 10 min on ice. Further, cell lysate was sonicated to shear DNA to lengths between 200 and 500 bp using ultrasound homogenizator and spun for 10 min at 13000 g at 4˚C. After centrifugation, 200 µl of supernatant fraction was transferred into a new tube and diluted in 1800 µl of cold ChIp dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA pH 8.0, 16.7 mM tris pH 8.1, 167 mM NaCl, 1 mM PMSF, 1 tablet protease inhibitor cocktail pro 10 ml). Twenty microliters (1/100 volume) of this solution was kept to quantitate the DNA amount in different lysates and this probe was considered to be the “input” control.

2.2.13.2 Immunoprecipitation To reduce nonspecific background, the diluted cell supernatant was pre-cleared with 80 µl of salmon sperm DNA/protein A agarose using following protocol: 80 µl of salmon sperm DNA/protein A agarose was added to the 2 ml of cell lysate. After incubation for 1 h on ice, the cell lysate was spun for 1 min at 1000 rpm and supernatant fraction was transferred to a new tube for immunoprecipitation. After adding of 2 µg of antibodies (H3-trimethyl lysine 9 or acetyl-H3 or Sp1), cell lysate was incubated overnight at 4°C. Further, the antibody/chromatin complex was isolated by adding of 60 µl of salmon sperm DNA/protein A agarose, incubating for 1 h on ice and pelleting for 1 min at 1000 rpm. For a negative control, a no antibody immunoprecipitation was utilized.

2 Materials and methods

44

The protein A agarose/antibody/protein complex was washed with 1 ml of low salt immune complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH 8.0, 20 mM tris pH 8.1, 150 mM NaCl), 1 ml of high salt immune complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH 8.0, 20 mM tris pH 8.1, 500 mM NaCl), 1 ml of LiCl immune complex wash buffer (0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA pH 8.0, 10 mM tris pH 8.1) and 2 ml of TE buffer (10 mM tris pH 8.0, 1 mM EDTA pH 8.0 ).

2.2.13.3 Extraction of immunoprecipitated DNA For quantitative PCR analysis, the DNA was eluted from agarose beads as follows. The protein A agarose/antibody/protein complex was incubated in 250 µl of elution buffer (1% SDS, 0.1 M NaHCO3) for 15 min at RT. After pulse centrifugation, the eluate was collected. The elution step was performed twice. Reverse protein-DNA crosslinking was performed by adding of 20 µl of 5 M NaCl to the combined eluates (500 µl) and incubating overnight at 65°C. Analogously, “Input” sample was treated in 0.2 M NaCl overnight at 65°C. After this treatment, the following solutions: 10 µl of 0.5 M EDTA pH 8.0, 20 µl of 1 M tris pH 7.0 and 2 µl of 10 mg/ml Proteinase K were added to DNA in “input” sample and to immunoprecipitated DNA. The DNA was incubated for 3 h at 45°C. After phenol extraction and precipitation, the DNA was dissolved in 50 µl of water. The histone modifications and Sp1 binding were quantified by real time PCR using the primers listed in Table 2-11. “Input” sample and “no antibody” probe were used as positive (100%) and background (0%) controls, respectively.

2.2.13.4 Real time PCR of immunoprecipitated DNA Real time PCR was carried out in the LightCycler “Rotor Gene 2000” using SybrTM green I detection. Reactions were set up in 25 µl of volume with the following final concentrations: 1x Taq buffer (1.5 mM MgCl2), 1 unit of Fast Taq polymerase (Roche), 0.25 mM dNTPs each, 10 pmoles of each primer (Table 2-11), 0.2 x SybrTM Green I, formamide (Table 2-11) and 2 µl of DNA. After an initial denaturation step for 5 min at 95°C, the cycling conditions were as follows: 95°C for 20 s, Tan (Table 2-11) for 30 s 72°C for 30 s and a fluorescence measurement after 15 s of appropriate

2 Materials and methods

45

Tm (Table 2-11) for a total of 50 cycles. The last elongation step was performed for 5 min at 72°C. Further, the melting temperatures of the PCR products were analyzed by a fluorescence measurement at every 1°C step after 5 s from 70°C up to 99°C. The amplification of PCR products was verified using the melting curve option (see chapter 2.2.9.2) and subsequence electrophoresis in 2% TBE agarose gel. All measurements were performed thrice. Data analysis was performed using the comparative method described in a chapter 2.2.9.3. (Rotor Gene Software version 4.6). The amount of DNA in analyzed samples was plotted relative to DNA amount in “input” sample (100%) using comparative method. A DNA amount in “no antibody” probe was defined as background control (0%).

Table 2-11. ChIp: Primers and conditions. Primers (5’→3’)

1

Tan, ºC

Tm, ºC

FA1, %

PCR product size, bp

A2

U: GATCACGGTCCAGCCTCTG L: CTCGAGCCTTCACTTGGGGT

62

85

2

109

A1

U: CTGGGGGAGGCGCTGAAGTC L: GCTCAGGCTCCCCCGACATG

62

85

4

115

C1

U: CGATTTCCCGGCGGCACA L: CCAGCGTCCGGGCAAGCG

60

85

4

200

Formamide concentration in PCR mix.